Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125612916:

Variant ID: vg1125612916 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25612916
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, G: 0.25, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAAGTGATGGTTTCTCCACCAGTGGTAACCCCACACGAAACCCTAACGACCTAGAGGCTATCGAAATCTGTTCACACGCTCCCGCCCACCCCCACTTA[T/G]
AACCCTAACTCTGCGATTGTCGAAATCCGTCAGTCTGCTCATCGTGCGTGTACGCTCGCGGAATTATGCGAGAACGGAGTAATGCTGATTTATGAGGTTG

Reverse complement sequence

CAACCTCATAAATCAGCATTACTCCGTTCTCGCATAATTCCGCGAGCGTACACGCACGATGAGCAGACTGACGGATTTCGACAATCGCAGAGTTAGGGTT[A/C]
TAAGTGGGGGTGGGCGGGAGCGTGTGAACAGATTTCGATAGCCTCTAGGTCGTTAGGGTTTCGTGTGGGGTTACCACTGGTGGAGAAACCATCACTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.70%	47.40%	0.15%	0.68%	NA
All Indica	2759	78.30%	21.40%	0.18%	0.07%	NA
All Japonica	1512	6.10%	91.90%	0.07%	1.98%	NA
Aus	269	33.10%	66.50%	0.37%	0.00%	NA
Indica I	595	49.70%	49.90%	0.34%	0.00%	NA
Indica II	465	94.60%	5.40%	0.00%	0.00%	NA
Indica III	913	85.70%	14.00%	0.11%	0.22%	NA
Indica Intermediate	786	81.80%	17.90%	0.25%	0.00%	NA
Temperate Japonica	767	3.50%	96.50%	0.00%	0.00%	NA
Tropical Japonica	504	11.10%	83.30%	0.00%	5.56%	NA
Japonica Intermediate	241	3.70%	95.00%	0.41%	0.83%	NA
VI/Aromatic	96	55.20%	44.80%	0.00%	0.00%	NA
Intermediate	90	55.60%	44.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125612916	T -> DEL	N	N	silent_mutation	Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1125612916	T -> G	LOC_Os11g42530.1	upstream_gene_variant ; 467.0bp to feature; MODIFIER	silent_mutation	Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1125612916	T -> G	LOC_Os11g42540.1	upstream_gene_variant ; 1590.0bp to feature; MODIFIER	silent_mutation	Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1125612916	T -> G	LOC_Os11g42550.1	upstream_gene_variant ; 4791.0bp to feature; MODIFIER	silent_mutation	Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1125612916	T -> G	LOC_Os11g42540.2	upstream_gene_variant ; 1590.0bp to feature; MODIFIER	silent_mutation	Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1125612916	T -> G	LOC_Os11g42520.1	downstream_gene_variant ; 4120.0bp to feature; MODIFIER	silent_mutation	Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1125612916	T -> G	LOC_Os11g42525.1	downstream_gene_variant ; 765.0bp to feature; MODIFIER	silent_mutation	Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1125612916	T -> G	LOC_Os11g42525-LOC_Os11g42530	intergenic_region ; MODIFIER	silent_mutation	Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125612916	NA	8.52E-07	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	1.60E-06	1.60E-06	mr1068	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	NA	4.57E-07	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	6.48E-15	1.69E-20	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	2.50E-12	1.71E-10	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	NA	7.83E-06	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	6.09E-07	6.09E-07	mr1526	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	NA	1.47E-06	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	NA	2.25E-12	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	1.33E-18	1.26E-21	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	1.66E-16	3.26E-12	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	NA	8.76E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	NA	2.79E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	NA	2.24E-12	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	NA	8.73E-06	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	NA	5.77E-06	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	NA	2.13E-06	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	NA	5.74E-06	mr1094_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	3.75E-06	3.75E-06	mr1111_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	4.15E-06	8.13E-08	mr1121_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	1.17E-17	1.04E-24	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916	6.29E-17	5.44E-12	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251