\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125612916:

Variant ID: vg1125612916 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25612916
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, G: 0.25, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAAGTGATGGTTTCTCCACCAGTGGTAACCCCACACGAAACCCTAACGACCTAGAGGCTATCGAAATCTGTTCACACGCTCCCGCCCACCCCCACTTA[T/G]
AACCCTAACTCTGCGATTGTCGAAATCCGTCAGTCTGCTCATCGTGCGTGTACGCTCGCGGAATTATGCGAGAACGGAGTAATGCTGATTTATGAGGTTG

Reverse complement sequence

CAACCTCATAAATCAGCATTACTCCGTTCTCGCATAATTCCGCGAGCGTACACGCACGATGAGCAGACTGACGGATTTCGACAATCGCAGAGTTAGGGTT[A/C]
TAAGTGGGGGTGGGCGGGAGCGTGTGAACAGATTTCGATAGCCTCTAGGTCGTTAGGGTTTCGTGTGGGGTTACCACTGGTGGAGAAACCATCACTTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 47.40% 0.15% 0.68% NA
All Indica  2759 78.30% 21.40% 0.18% 0.07% NA
All Japonica  1512 6.10% 91.90% 0.07% 1.98% NA
Aus  269 33.10% 66.50% 0.37% 0.00% NA
Indica I  595 49.70% 49.90% 0.34% 0.00% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 85.70% 14.00% 0.11% 0.22% NA
Indica Intermediate  786 81.80% 17.90% 0.25% 0.00% NA
Temperate Japonica  767 3.50% 96.50% 0.00% 0.00% NA
Tropical Japonica  504 11.10% 83.30% 0.00% 5.56% NA
Japonica Intermediate  241 3.70% 95.00% 0.41% 0.83% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125612916 T -> DEL N N silent_mutation Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1125612916 T -> G LOC_Os11g42530.1 upstream_gene_variant ; 467.0bp to feature; MODIFIER silent_mutation Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1125612916 T -> G LOC_Os11g42540.1 upstream_gene_variant ; 1590.0bp to feature; MODIFIER silent_mutation Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1125612916 T -> G LOC_Os11g42550.1 upstream_gene_variant ; 4791.0bp to feature; MODIFIER silent_mutation Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1125612916 T -> G LOC_Os11g42540.2 upstream_gene_variant ; 1590.0bp to feature; MODIFIER silent_mutation Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1125612916 T -> G LOC_Os11g42520.1 downstream_gene_variant ; 4120.0bp to feature; MODIFIER silent_mutation Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1125612916 T -> G LOC_Os11g42525.1 downstream_gene_variant ; 765.0bp to feature; MODIFIER silent_mutation Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1125612916 T -> G LOC_Os11g42525-LOC_Os11g42530 intergenic_region ; MODIFIER silent_mutation Average:54.427; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125612916 NA 8.52E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 1.60E-06 1.60E-06 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 NA 4.57E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 6.48E-15 1.69E-20 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 2.50E-12 1.71E-10 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 NA 7.83E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 6.09E-07 6.09E-07 mr1526 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 NA 1.47E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 NA 2.25E-12 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 1.33E-18 1.26E-21 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 1.66E-16 3.26E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 NA 8.76E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 NA 2.79E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 NA 2.24E-12 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 NA 8.73E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 NA 5.77E-06 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 NA 2.13E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 NA 5.74E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 3.75E-06 3.75E-06 mr1111_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 4.15E-06 8.13E-08 mr1121_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 1.17E-17 1.04E-24 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125612916 6.29E-17 5.44E-12 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251