\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125609790:

Variant ID: vg1125609790 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25609790
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAGACGAGAGGGACGAGGGAGCGAGAGGAGGCGGCATCAAGTTTGTTGGATCTAGCTCCCGCCACACCATCGTACCTTCTCCCTAACTGTGCTGTCGC[T/C]
GTACTTTCTACACGACTGCTCCGCCGATGCATCCGCATTAATTGGCAAAAAAAATAGTGGTCATTTTCCATACGAACCCCTAGGATATAATATGATGTAT

Reverse complement sequence

ATACATCATATTATATCCTAGGGGTTCGTATGGAAAATGACCACTATTTTTTTTGCCAATTAATGCGGATGCATCGGCGGAGCAGTCGTGTAGAAAGTAC[A/G]
GCGACAGCACAGTTAGGGAGAAGGTACGATGGTGTGGCGGGAGCTAGATCCAACAAACTTGATGCCGCCTCCTCTCGCTCCCTCGTCCCTCTCGTCTGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 48.50% 0.15% 0.70% NA
All Indica  2759 29.20% 70.50% 0.22% 0.07% NA
All Japonica  1512 90.90% 7.00% 0.00% 2.05% NA
Aus  269 45.70% 54.30% 0.00% 0.00% NA
Indica I  595 81.70% 18.00% 0.34% 0.00% NA
Indica II  465 22.60% 76.80% 0.65% 0.00% NA
Indica III  913 4.20% 95.60% 0.00% 0.22% NA
Indica Intermediate  786 22.50% 77.40% 0.13% 0.00% NA
Temperate Japonica  767 96.00% 4.00% 0.00% 0.00% NA
Tropical Japonica  504 82.70% 11.50% 0.00% 5.75% NA
Japonica Intermediate  241 92.10% 7.10% 0.00% 0.83% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125609790 T -> DEL N N silent_mutation Average:76.774; most accessible tissue: Callus, score: 96.87 N N N N
vg1125609790 T -> C LOC_Os11g42525.1 upstream_gene_variant ; 1995.0bp to feature; MODIFIER silent_mutation Average:76.774; most accessible tissue: Callus, score: 96.87 N N N N
vg1125609790 T -> C LOC_Os11g42530.1 upstream_gene_variant ; 3593.0bp to feature; MODIFIER silent_mutation Average:76.774; most accessible tissue: Callus, score: 96.87 N N N N
vg1125609790 T -> C LOC_Os11g42540.1 upstream_gene_variant ; 4716.0bp to feature; MODIFIER silent_mutation Average:76.774; most accessible tissue: Callus, score: 96.87 N N N N
vg1125609790 T -> C LOC_Os11g42540.2 upstream_gene_variant ; 4716.0bp to feature; MODIFIER silent_mutation Average:76.774; most accessible tissue: Callus, score: 96.87 N N N N
vg1125609790 T -> C LOC_Os11g42520.1 downstream_gene_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:76.774; most accessible tissue: Callus, score: 96.87 N N N N
vg1125609790 T -> C LOC_Os11g42520-LOC_Os11g42525 intergenic_region ; MODIFIER silent_mutation Average:76.774; most accessible tissue: Callus, score: 96.87 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125609790 NA 1.60E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 1.41E-06 1.87E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 8.04E-06 8.04E-06 mr1191 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 7.57E-06 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 3.19E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 2.32E-07 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 8.93E-06 NA mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 3.45E-07 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 1.17E-06 mr1580 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 2.91E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 8.78E-07 8.78E-07 mr1644 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 1.04E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 1.82E-09 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 1.10E-09 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 1.78E-08 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 5.47E-06 1.46E-17 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 4.06E-07 5.38E-10 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 1.42E-06 1.42E-06 mr1191_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 1.46E-06 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 4.22E-07 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 2.33E-06 8.17E-14 mr1667_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 6.66E-06 2.90E-07 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790 NA 3.69E-08 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251