Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125609790:

Variant ID: vg1125609790 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25609790
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TGCAGACGAGAGGGACGAGGGAGCGAGAGGAGGCGGCATCAAGTTTGTTGGATCTAGCTCCCGCCACACCATCGTACCTTCTCCCTAACTGTGCTGTCGC[T/C]
GTACTTTCTACACGACTGCTCCGCCGATGCATCCGCATTAATTGGCAAAAAAAATAGTGGTCATTTTCCATACGAACCCCTAGGATATAATATGATGTAT

Reverse complement sequence

ATACATCATATTATATCCTAGGGGTTCGTATGGAAAATGACCACTATTTTTTTTGCCAATTAATGCGGATGCATCGGCGGAGCAGTCGTGTAGAAAGTAC[A/G]
GCGACAGCACAGTTAGGGAGAAGGTACGATGGTGTGGCGGGAGCTAGATCCAACAAACTTGATGCCGCCTCCTCTCGCTCCCTCGTCCCTCTCGTCTGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.70%	48.50%	0.15%	0.70%	NA
All Indica	2759	29.20%	70.50%	0.22%	0.07%	NA
All Japonica	1512	90.90%	7.00%	0.00%	2.05%	NA
Aus	269	45.70%	54.30%	0.00%	0.00%	NA
Indica I	595	81.70%	18.00%	0.34%	0.00%	NA
Indica II	465	22.60%	76.80%	0.65%	0.00%	NA
Indica III	913	4.20%	95.60%	0.00%	0.22%	NA
Indica Intermediate	786	22.50%	77.40%	0.13%	0.00%	NA
Temperate Japonica	767	96.00%	4.00%	0.00%	0.00%	NA
Tropical Japonica	504	82.70%	11.50%	0.00%	5.75%	NA
Japonica Intermediate	241	92.10%	7.10%	0.00%	0.83%	NA
VI/Aromatic	96	43.80%	56.20%	0.00%	0.00%	NA
Intermediate	90	55.60%	43.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125609790	T -> DEL	N	N	silent_mutation	Average:76.774; most accessible tissue: Callus, score: 96.87	N	N	N	N
vg1125609790	T -> C	LOC_Os11g42525.1	upstream_gene_variant ; 1995.0bp to feature; MODIFIER	silent_mutation	Average:76.774; most accessible tissue: Callus, score: 96.87	N	N	N	N
vg1125609790	T -> C	LOC_Os11g42530.1	upstream_gene_variant ; 3593.0bp to feature; MODIFIER	silent_mutation	Average:76.774; most accessible tissue: Callus, score: 96.87	N	N	N	N
vg1125609790	T -> C	LOC_Os11g42540.1	upstream_gene_variant ; 4716.0bp to feature; MODIFIER	silent_mutation	Average:76.774; most accessible tissue: Callus, score: 96.87	N	N	N	N
vg1125609790	T -> C	LOC_Os11g42540.2	upstream_gene_variant ; 4716.0bp to feature; MODIFIER	silent_mutation	Average:76.774; most accessible tissue: Callus, score: 96.87	N	N	N	N
vg1125609790	T -> C	LOC_Os11g42520.1	downstream_gene_variant ; 994.0bp to feature; MODIFIER	silent_mutation	Average:76.774; most accessible tissue: Callus, score: 96.87	N	N	N	N
vg1125609790	T -> C	LOC_Os11g42520-LOC_Os11g42525	intergenic_region ; MODIFIER	silent_mutation	Average:76.774; most accessible tissue: Callus, score: 96.87	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125609790	NA	1.60E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	1.41E-06	1.87E-07	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	8.04E-06	8.04E-06	mr1191	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	7.57E-06	mr1358	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	3.19E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	2.32E-07	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	8.93E-06	NA	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	3.45E-07	mr1530	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	1.17E-06	mr1580	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	2.91E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	8.78E-07	8.78E-07	mr1644	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	1.04E-07	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	1.82E-09	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	1.10E-09	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	1.78E-08	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	5.47E-06	1.46E-17	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	4.06E-07	5.38E-10	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	1.42E-06	1.42E-06	mr1191_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	1.46E-06	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	4.22E-07	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	2.33E-06	8.17E-14	mr1667_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	6.66E-06	2.90E-07	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125609790	NA	3.69E-08	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251