Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125601372:

Variant ID: vg1125601372 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25601372
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CTAAATATGCTAAGGTATTGTTACCTTTCTCAAGAAACAATGAAACATTACTCCATCTATCCCAAAATATAGCAATGTAATATTGATTGGATCCTATTTT[G/A]
GGACGGAGGGGTATATATCTTTGACTTTTCAAATTCAAAAAAAAAAACATACCAGTTTGATCATTCAATTTTCTTTCTTCATATATCTAACATCTATACT

Reverse complement sequence

AGTATAGATGTTAGATATATGAAGAAAGAAAATTGAATGATCAAACTGGTATGTTTTTTTTTTTGAATTTGAAAAGTCAAAGATATATACCCCTCCGTCC[C/T]
AAAATAGGATCCAATCAATATTACATTGCTATATTTTGGGATAGATGGAGTAATGTTTCATTGTTTCTTGAGAAAGGTAACAATACCTTAGCATATTTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.20%	16.70%	0.06%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	49.70%	50.10%	0.20%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	1.00%	0.00%	0.00%	NA
Temperate Japonica	767	58.70%	41.10%	0.26%	0.00%	NA
Tropical Japonica	504	34.50%	65.30%	0.20%	0.00%	NA
Japonica Intermediate	241	53.10%	46.90%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125601372	G -> A	LOC_Os11g42510.1	intron_variant ; MODIFIER	silent_mutation	Average:47.304; most accessible tissue: Minghui63 flower, score: 68.171	N	N	N	N
vg1125601372	G -> A	LOC_Os11g42510.2	intron_variant ; MODIFIER	silent_mutation	Average:47.304; most accessible tissue: Minghui63 flower, score: 68.171	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125601372	2.30E-06	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125601372	2.63E-07	1.10E-19	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125601372	3.35E-06	3.35E-06	mr1609	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125601372	1.24E-08	NA	mr1745	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125601372	NA	2.07E-13	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125601372	NA	1.45E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125601372	6.85E-06	1.53E-24	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125601372	7.37E-07	NA	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125601372	NA	8.19E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125601372	3.04E-06	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251