\
| Variant ID: vg1125601372 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25601372 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 236. )
CTAAATATGCTAAGGTATTGTTACCTTTCTCAAGAAACAATGAAACATTACTCCATCTATCCCAAAATATAGCAATGTAATATTGATTGGATCCTATTTT[G/A]
GGACGGAGGGGTATATATCTTTGACTTTTCAAATTCAAAAAAAAAAACATACCAGTTTGATCATTCAATTTTCTTTCTTCATATATCTAACATCTATACT
AGTATAGATGTTAGATATATGAAGAAAGAAAATTGAATGATCAAACTGGTATGTTTTTTTTTTTGAATTTGAAAAGTCAAAGATATATACCCCTCCGTCC[C/T]
AAAATAGGATCCAATCAATATTACATTGCTATATTTTGGGATAGATGGAGTAATGTTTCATTGTTTCTTGAGAAAGGTAACAATACCTTAGCATATTTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.20% | 16.70% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 49.70% | 50.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 58.70% | 41.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 34.50% | 65.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125601372 | G -> A | LOC_Os11g42510.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.304; most accessible tissue: Minghui63 flower, score: 68.171 | N | N | N | N |
| vg1125601372 | G -> A | LOC_Os11g42510.2 | intron_variant ; MODIFIER | silent_mutation | Average:47.304; most accessible tissue: Minghui63 flower, score: 68.171 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125601372 | 2.30E-06 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125601372 | 2.63E-07 | 1.10E-19 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125601372 | 3.35E-06 | 3.35E-06 | mr1609 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125601372 | 1.24E-08 | NA | mr1745 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125601372 | NA | 2.07E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125601372 | NA | 1.45E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125601372 | 6.85E-06 | 1.53E-24 | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125601372 | 7.37E-07 | NA | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125601372 | NA | 8.19E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125601372 | 3.04E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |