\
| Variant ID: vg1125600946 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25600946 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 113. )
AAATTTTTGTGCAAATATGAAAATATTTATATCATACTTAAAGAACATTTGATGATGAATCTAGTCACAATAAAATAAATGAAAATTACATAAATTTTTT[G/A]
AATAAGACAAATGGTCAAACGTTAGATAAAAAATCAACGGCGTCATAGATTAAAATATGGAGGTAGTACTATGCGATTGCAAGTACAACAGGGCCAGATA
TATCTGGCCCTGTTGTACTTGCAATCGCATAGTACTACCTCCATATTTTAATCTATGACGCCGTTGATTTTTTATCTAACGTTTGACCATTTGTCTTATT[C/T]
AAAAAATTTATGTAATTTTCATTTATTTTATTGTGACTAGATTCATCATCAAATGTTCTTTAAGTATGATATAAATATTTTCATATTTGCACAAAAATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.30% | 15.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 94.50% | 5.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 62.10% | 37.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.20% | 7.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 79.70% | 20.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 38.50% | 61.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125600946 | G -> A | LOC_Os11g42510.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.949; most accessible tissue: Minghui63 flower, score: 75.689 | N | N | N | N |
| vg1125600946 | G -> A | LOC_Os11g42510.2 | intron_variant ; MODIFIER | silent_mutation | Average:49.949; most accessible tissue: Minghui63 flower, score: 75.689 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125600946 | NA | 9.33E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 1.50E-10 | NA | mr1238 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 1.98E-13 | 1.15E-13 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 1.06E-08 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 1.85E-08 | 5.88E-09 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | NA | 6.09E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 2.35E-08 | 3.60E-17 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | NA | 3.86E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 1.31E-06 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 2.95E-07 | 4.31E-07 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 1.11E-06 | 3.37E-16 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 5.65E-09 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 7.55E-11 | 2.79E-11 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 5.99E-09 | NA | mr1484_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 2.68E-10 | 3.39E-11 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 2.16E-10 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 3.75E-12 | 6.48E-12 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 4.41E-08 | 2.30E-20 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 4.51E-07 | 1.67E-07 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 7.73E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125600946 | 8.48E-07 | 8.48E-07 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |