\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125581255:

Variant ID: vg1125581255 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25581255
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.08, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CGCATGCCTTGCTTCTCTATTGGAATGTTTATAAACTTTTATCCACACTAAGATATTGTAGCATTTTTATGCTAATTAAAGTATTATAATCCAGTAACTA[C/T]
GCGTGATTAATTGGCTCTGTGATAATATGAGATTTTCTAAAAAAAAATAAGACTACGTAGATGGTTCGCCGGTTGGCATCTTCCGATGCATTATGCGTGC

Reverse complement sequence

GCACGCATAATGCATCGGAAGATGCCAACCGGCGAACCATCTACGTAGTCTTATTTTTTTTTAGAAAATCTCATATTATCACAGAGCCAATTAATCACGC[G/A]
TAGTTACTGGATTATAATACTTTAATTAGCATAAAAATGCTACAATATCTTAGTGTGGATAAAAGTTTATAAACATTCCAATAGAGAAGCAAGGCATGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 39.10% 0.13% 0.00% NA
All Indica  2759 68.90% 31.00% 0.11% 0.00% NA
All Japonica  1512 45.80% 54.10% 0.07% 0.00% NA
Aus  269 62.80% 36.80% 0.37% 0.00% NA
Indica I  595 49.10% 50.90% 0.00% 0.00% NA
Indica II  465 39.80% 60.00% 0.22% 0.00% NA
Indica III  913 95.40% 4.50% 0.11% 0.00% NA
Indica Intermediate  786 70.50% 29.40% 0.13% 0.00% NA
Temperate Japonica  767 21.60% 78.20% 0.13% 0.00% NA
Tropical Japonica  504 81.00% 19.00% 0.00% 0.00% NA
Japonica Intermediate  241 49.40% 50.60% 0.00% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 57.80% 41.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125581255 C -> T LOC_Os11g42470.1 upstream_gene_variant ; 1055.0bp to feature; MODIFIER silent_mutation Average:62.364; most accessible tissue: Callus, score: 92.891 N N N N
vg1125581255 C -> T LOC_Os11g42480.1 downstream_gene_variant ; 2709.0bp to feature; MODIFIER silent_mutation Average:62.364; most accessible tissue: Callus, score: 92.891 N N N N
vg1125581255 C -> T LOC_Os11g42450-LOC_Os11g42470 intergenic_region ; MODIFIER silent_mutation Average:62.364; most accessible tissue: Callus, score: 92.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125581255 5.08E-09 9.24E-15 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 8.02E-23 2.97E-26 mr1191 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 4.34E-21 1.99E-22 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 3.79E-07 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 5.02E-07 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 1.40E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 4.22E-30 4.77E-39 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 1.31E-29 4.86E-32 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 5.41E-06 5.46E-09 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 2.28E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 6.79E-07 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 2.46E-10 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 4.35E-23 8.78E-33 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 5.96E-26 2.09E-29 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 2.15E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 1.56E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 4.56E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 4.60E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 4.33E-07 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 4.42E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 2.61E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581255 NA 1.45E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251