\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125578856:

Variant ID: vg1125578856 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25578856
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.21, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GAGAATGGAGAGAACCGGCGCCGCTTGGAGCGAGAGCGGAGTGTTGCAGCAGCTCGGGCGGTGTCATATTAGGGCGTTCACAATGGGATGAGGTGTCGTT[T/C]
GGCCTCAAACGCGCACGTTGGATGCGGGAGAGAAATCAGCGCCACGTGACAGGAAGGGCCCACCAATTCCTAGCGCGCGTGACCAGAGTTAGCCATCCGT

Reverse complement sequence

ACGGATGGCTAACTCTGGTCACGCGCGCTAGGAATTGGTGGGCCCTTCCTGTCACGTGGCGCTGATTTCTCTCCCGCATCCAACGTGCGCGTTTGAGGCC[A/G]
AACGACACCTCATCCCATTGTGAACGCCCTAATATGACACCGCCCGAGCTGCTGCAACACTCCGCTCTCGCTCCAAGCGGCGCCGGTTCTCTCCATTCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.70% 0.04% 0.00% NA
All Indica  2759 68.20% 31.80% 0.04% 0.00% NA
All Japonica  1512 45.60% 54.30% 0.07% 0.00% NA
Aus  269 62.50% 37.50% 0.00% 0.00% NA
Indica I  595 49.40% 50.60% 0.00% 0.00% NA
Indica II  465 40.60% 59.40% 0.00% 0.00% NA
Indica III  913 93.20% 6.70% 0.11% 0.00% NA
Indica Intermediate  786 69.70% 30.30% 0.00% 0.00% NA
Temperate Japonica  767 21.30% 78.70% 0.00% 0.00% NA
Tropical Japonica  504 81.00% 19.00% 0.00% 0.00% NA
Japonica Intermediate  241 49.40% 50.20% 0.41% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125578856 T -> C LOC_Os11g42470.1 upstream_gene_variant ; 3454.0bp to feature; MODIFIER silent_mutation Average:64.737; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg1125578856 T -> C LOC_Os11g42450-LOC_Os11g42470 intergenic_region ; MODIFIER silent_mutation Average:64.737; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125578856 7.59E-09 2.50E-14 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 3.78E-13 5.63E-17 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 1.83E-18 8.84E-21 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 5.66E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 2.37E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 3.10E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 1.82E-20 2.19E-27 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 3.51E-28 2.13E-31 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 1.01E-06 1.52E-09 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 6.13E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 5.17E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 5.11E-10 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 1.06E-15 8.91E-24 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 1.54E-26 1.06E-29 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 2.13E-06 NA mr1236_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 1.94E-08 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 2.70E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 1.38E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 7.50E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 4.78E-07 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 8.83E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 7.69E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 5.32E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125578856 NA 2.53E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251