Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125576537:

Variant ID: vg1125576537 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25576537
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAGAAACAAATAGCTTTCTTGGAGAAATTCTTTTTAGCAGCCCTATATAAAATTTGTAGATAATTTAGGTAGCACATGTCAACTGAAGGGGCGTTCAG[C/T]
GATAAAGCTCTTTTATACGAATTGACAGGCTGGATACATGTAAATGTGTGTGGAGATGGGCCGATATGTTCATGTGGGCTACATTTGGCACCGAGTAGAC

Reverse complement sequence

GTCTACTCGGTGCCAAATGTAGCCCACATGAACATATCGGCCCATCTCCACACACATTTACATGTATCCAGCCTGTCAATTCGTATAAAAGAGCTTTATC[G/A]
CTGAACGCCCCTTCAGTTGACATGTGCTACCTAAATTATCTACAAATTTTATATAGGGCTGCTAAAAAGAATTTCTCCAAGAAAGCTATTTGTTTCTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	37.50%	0.11%	0.00%	NA
All Indica	2759	69.30%	30.60%	0.18%	0.00%	NA
All Japonica	1512	49.70%	50.30%	0.00%	0.00%	NA
Aus	269	63.90%	36.10%	0.00%	0.00%	NA
Indica I	595	49.70%	50.30%	0.00%	0.00%	NA
Indica II	465	41.30%	57.80%	0.86%	0.00%	NA
Indica III	913	95.40%	4.50%	0.11%	0.00%	NA
Indica Intermediate	786	70.20%	29.80%	0.00%	0.00%	NA
Temperate Japonica	767	21.80%	78.20%	0.00%	0.00%	NA
Tropical Japonica	504	90.30%	9.70%	0.00%	0.00%	NA
Japonica Intermediate	241	53.50%	46.50%	0.00%	0.00%	NA
VI/Aromatic	96	55.20%	44.80%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125576537	C -> T	LOC_Os11g42450-LOC_Os11g42470	intergenic_region ; MODIFIER	silent_mutation	Average:43.573; most accessible tissue: Callus, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125576537	1.20E-08	6.54E-15	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	2.55E-19	8.39E-23	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	9.48E-21	1.24E-22	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	NA	8.35E-06	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	NA	5.30E-06	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	NA	3.57E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	1.19E-25	5.74E-34	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	1.07E-27	5.22E-31	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	2.13E-06	1.74E-09	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	NA	2.90E-06	mr1908	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	NA	3.61E-11	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	2.53E-23	1.35E-30	mr1191_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	9.36E-25	4.40E-29	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	NA	2.02E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	NA	5.69E-07	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	NA	1.97E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	NA	1.18E-06	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	NA	2.37E-07	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	NA	2.04E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125576537	NA	3.15E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251