\
| Variant ID: vg1125566004 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25566004 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 245. )
TTATATAGAAAATCTTTAGTCTACCAACATTGTAAATAAAAATCAACAATCTTGATCTAGTCCGTGTATCCAAACTAACAAACTAACTTTGCTTCTCGAT[C/T]
GTTACAAAATAATTCATAATTACTATAGATGGAAGTTGATAAAGTATATGCGTTTGTAATGAGAAATGATTGTTGAGATGTTTGTGATGAGTCTGTTTGA
TCAAACAGACTCATCACAAACATCTCAACAATCATTTCTCATTACAAACGCATATACTTTATCAACTTCCATCTATAGTAATTATGAATTATTTTGTAAC[G/A]
ATCGAGAAGCAAAGTTAGTTTGTTAGTTTGGATACACGGACTAGATCAAGATTGTTGATTTTTATTTACAATGTTGGTAGACTAAAGATTTTCTATATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.10% | 20.00% | 0.11% | 0.87% | NA |
| All Indica | 2759 | 66.80% | 32.90% | 0.07% | 0.18% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 82.90% | 3.70% | 0.37% | 13.01% | NA |
| Indica I | 595 | 92.90% | 6.90% | 0.00% | 0.17% | NA |
| Indica II | 465 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 43.30% | 56.40% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 66.40% | 33.20% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 15.60% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125566004 | C -> T | LOC_Os11g42450-LOC_Os11g42470 | intergenic_region ; MODIFIER | silent_mutation | Average:25.271; most accessible tissue: Callus, score: 57.769 | N | N | N | N |
| vg1125566004 | C -> DEL | N | N | silent_mutation | Average:25.271; most accessible tissue: Callus, score: 57.769 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125566004 | 4.26E-06 | NA | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | 1.78E-07 | 5.34E-14 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | 4.56E-09 | 2.70E-12 | mr1191 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | 2.63E-06 | 7.69E-07 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | 3.39E-16 | 1.66E-18 | mr1644 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | 2.13E-12 | 5.26E-12 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | NA | 1.34E-08 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | NA | 1.82E-09 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | NA | 5.50E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | NA | 1.83E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | NA | 5.14E-11 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | 5.35E-10 | NA | mr1191_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | 1.19E-07 | 1.67E-06 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | NA | 1.78E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | NA | 4.86E-08 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125566004 | NA | 3.54E-06 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |