\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125556483:

Variant ID: vg1125556483 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25556483
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAACCACTGGAAAGGTTAAAAGGATCACAACAATTCTAACTGGTTAGCCTACATTTATTACAAGGAATCATACACTCTTTGCTATCAATTGTAAGA[G/A]
TATTTTAATCGTGGAATGAAAGACTCTTCACTACAGATTTTAAGAGTATAACATCAACAAGCATAGTAGTATCATATGCATAGTGGAACAAAATAAAGGT

Reverse complement sequence

ACCTTTATTTTGTTCCACTATGCATATGATACTACTATGCTTGTTGATGTTATACTCTTAAAATCTGTAGTGAAGAGTCTTTCATTCCACGATTAAAATA[C/T]
TCTTACAATTGATAGCAAAGAGTGTATGATTCCTTGTAATAAATGTAGGCTAACCAGTTAGAATTGTTGTGATCCTTTTAACCTTTCCAGTGGTTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.90% 17.90% 0.40% 2.71% NA
All Indica  2759 97.60% 0.50% 0.22% 1.59% NA
All Japonica  1512 44.80% 54.00% 0.20% 0.99% NA
Aus  269 90.70% 0.40% 1.12% 7.81% NA
Indica I  595 98.20% 0.30% 0.00% 1.51% NA
Indica II  465 98.70% 0.60% 0.43% 0.22% NA
Indica III  913 97.00% 0.20% 0.44% 2.30% NA
Indica Intermediate  786 97.30% 1.00% 0.00% 1.65% NA
Temperate Japonica  767 49.90% 48.90% 0.00% 1.17% NA
Tropical Japonica  504 35.90% 63.50% 0.20% 0.40% NA
Japonica Intermediate  241 47.30% 50.20% 0.83% 1.66% NA
VI/Aromatic  96 49.00% 0.00% 6.25% 44.79% NA
Intermediate  90 75.60% 17.80% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125556483 G -> A LOC_Os11g42450.1 downstream_gene_variant ; 2928.0bp to feature; MODIFIER silent_mutation Average:62.793; most accessible tissue: Callus, score: 95.063 N N N N
vg1125556483 G -> A LOC_Os11g42450-LOC_Os11g42470 intergenic_region ; MODIFIER silent_mutation Average:62.793; most accessible tissue: Callus, score: 95.063 N N N N
vg1125556483 G -> DEL N N silent_mutation Average:62.793; most accessible tissue: Callus, score: 95.063 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125556483 6.87E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 3.97E-07 1.79E-19 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 NA 9.57E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 8.09E-06 8.09E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 1.20E-07 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 NA 2.67E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 NA 1.03E-09 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 5.88E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 2.79E-06 3.19E-10 mr1321_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 5.59E-06 6.17E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 5.01E-07 NA mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 NA 5.08E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 9.90E-06 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 NA 1.13E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 8.67E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125556483 NA 1.18E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251