Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125555777:

Variant ID: vg1125555777 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25555777
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGGCTAAAAAACAGGACGGATCATTAGCATATGATTAAGTTAGAATCAATTACTATAAATTTAAAAATAGGTTTATTTGATTTTTTTAAAAAAAACTT[C/A]
TACTAGCTCCATCCAAAAATGTAACATATGAAAAGTTTGGCACCGAAGAAATTAAAAAATAACTTTTTTTAAAAAAATATTGGCTAGAATATAAAGAATC

Reverse complement sequence

GATTCTTTATATTCTAGCCAATATTTTTTTAAAAAAAGTTATTTTTTAATTTCTTCGGTGCCAAACTTTTCATATGTTACATTTTTGGATGGAGCTAGTA[G/T]
AAGTTTTTTTTAAAAAAATCAAATAAACCTATTTTTAAATTTATAGTAATTGATTCTAACTTAATCATATGCTAATGATCCGTCCTGTTTTTTAGCCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 18.30% 0.02% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 44.70% 55.20% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 51.40% 48.60% 0.00% 0.00% NA
Tropical Japonica  504 34.90% 64.90% 0.20% 0.00% NA
Japonica Intermediate  241 44.00% 56.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125555777 C -> A LOC_Os11g42450.1 downstream_gene_variant ; 2222.0bp to feature; MODIFIER silent_mutation Average:55.123; most accessible tissue: Callus, score: 91.62 N N N N
vg1125555777 C -> A LOC_Os11g42450-LOC_Os11g42470 intergenic_region ; MODIFIER silent_mutation Average:55.123; most accessible tissue: Callus, score: 91.62 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125555777 C A 0.01 0.02 0.02 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125555777 1.06E-06 1.90E-26 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 8.20E-08 1.68E-20 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 NA 1.66E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 1.12E-06 1.12E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 1.88E-08 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 NA 5.71E-15 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 NA 8.99E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 8.32E-07 2.37E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 9.46E-06 1.24E-09 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 NA 9.29E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 7.04E-07 1.97E-26 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 7.04E-08 NA mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 9.48E-06 NA mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 3.76E-06 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 NA 3.33E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 7.18E-08 1.23E-31 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 NA 3.64E-06 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 4.86E-06 5.10E-22 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125555777 NA 3.59E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251