\
| Variant ID: vg1125547775 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25547775 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCAAAATTGGAAGTTTGATTGAAATTGAAACGATGTGATGGAAAAATTAAAAATTTGTGTGCGTAGGAAAGTTTCGATGTGATGAAAAAGTTAAAAGTTT[G/A]
AAGAAAAAGTTGAGAACTAAACTCAGCCTATGCTTTGATCGCCAAAATTTGTTTAACATGAAGAAGAAGGAACAGAGAAAATGAGTTCAAACCCTCTGTG
CACAGAGGGTTTGAACTCATTTTCTCTGTTCCTTCTTCTTCATGTTAAACAAATTTTGGCGATCAAAGCATAGGCTGAGTTTAGTTCTCAACTTTTTCTT[C/T]
AAACTTTTAACTTTTTCATCACATCGAAACTTTCCTACGCACACAAATTTTTAATTTTTCCATCACATCGTTTCAATTTCAATCAAACTTCCAATTTTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.30% | 3.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 87.70% | 11.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 46.90% | 53.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125547775 | G -> A | LOC_Os11g42450.1 | upstream_gene_variant ; 4337.0bp to feature; MODIFIER | silent_mutation | Average:42.457; most accessible tissue: Callus, score: 73.239 | N | N | N | N |
| vg1125547775 | G -> A | LOC_Os11g42440.1 | downstream_gene_variant ; 240.0bp to feature; MODIFIER | silent_mutation | Average:42.457; most accessible tissue: Callus, score: 73.239 | N | N | N | N |
| vg1125547775 | G -> A | LOC_Os11g42440-LOC_Os11g42450 | intergenic_region ; MODIFIER | silent_mutation | Average:42.457; most accessible tissue: Callus, score: 73.239 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125547775 | 5.90E-16 | 1.28E-12 | mr1191 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125547775 | 3.79E-13 | 1.77E-13 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125547775 | 2.94E-20 | 2.27E-13 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125547775 | NA | 2.65E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |