Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125547759:

Variant ID: vg1125547759 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25547759
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.36, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GTGTGTTTAGTTTACGCCAAAATTGGAAGTTTGATTGAAATTGAAACGATGTGATGGAAAAATTAAAAATTTGTGTGCGTAGGAAAGTTTCGATGTGATG[A/G]
AAAAGTTAAAAGTTTGAAGAAAAAGTTGAGAACTAAACTCAGCCTATGCTTTGATCGCCAAAATTTGTTTAACATGAAGAAGAAGGAACAGAGAAAATGA

Reverse complement sequence

TCATTTTCTCTGTTCCTTCTTCTTCATGTTAAACAAATTTTGGCGATCAAAGCATAGGCTGAGTTTAGTTCTCAACTTTTTCTTCAAACTTTTAACTTTT[T/C]
CATCACATCGAAACTTTCCTACGCACACAAATTTTTAATTTTTCCATCACATCGTTTCAATTTCAATCAAACTTCCAATTTTGGCGTAAACTAAACACAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.70%	43.20%	0.08%	0.00%	NA
All Indica	2759	69.40%	30.60%	0.07%	0.00%	NA
All Japonica	1512	32.00%	67.90%	0.07%	0.00%	NA
Aus	269	63.90%	36.10%	0.00%	0.00%	NA
Indica I	595	48.60%	51.30%	0.17%	0.00%	NA
Indica II	465	42.60%	57.40%	0.00%	0.00%	NA
Indica III	913	96.30%	3.70%	0.00%	0.00%	NA
Indica Intermediate	786	69.70%	30.20%	0.13%	0.00%	NA
Temperate Japonica	767	37.50%	62.50%	0.00%	0.00%	NA
Tropical Japonica	504	27.60%	72.20%	0.20%	0.00%	NA
Japonica Intermediate	241	23.70%	76.30%	0.00%	0.00%	NA
VI/Aromatic	96	55.20%	44.80%	0.00%	0.00%	NA
Intermediate	90	62.20%	36.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125547759	A -> G	LOC_Os11g42450.1	upstream_gene_variant ; 4353.0bp to feature; MODIFIER	silent_mutation	Average:44.845; most accessible tissue: Callus, score: 73.239	N	N	N	N
vg1125547759	A -> G	LOC_Os11g42440.1	downstream_gene_variant ; 224.0bp to feature; MODIFIER	silent_mutation	Average:44.845; most accessible tissue: Callus, score: 73.239	N	N	N	N
vg1125547759	A -> G	LOC_Os11g42440-LOC_Os11g42450	intergenic_region ; MODIFIER	silent_mutation	Average:44.845; most accessible tissue: Callus, score: 73.239	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125547759	4.24E-06	NA	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	3.77E-09	6.29E-15	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	3.32E-17	1.04E-27	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	8.81E-19	1.49E-21	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	NA	6.49E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	1.83E-20	3.90E-35	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	3.18E-25	2.09E-29	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	5.16E-07	NA	mr1667	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	8.11E-07	1.17E-09	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	NA	4.65E-06	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	NA	6.91E-06	mr1908	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	6.14E-06	2.60E-11	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	2.79E-21	2.15E-37	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	5.76E-24	1.39E-29	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	NA	7.20E-07	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	NA	1.96E-06	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	NA	6.81E-08	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759	NA	3.56E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251