\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125547759:

Variant ID: vg1125547759 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25547759
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.36, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTGTTTAGTTTACGCCAAAATTGGAAGTTTGATTGAAATTGAAACGATGTGATGGAAAAATTAAAAATTTGTGTGCGTAGGAAAGTTTCGATGTGATG[A/G]
AAAAGTTAAAAGTTTGAAGAAAAAGTTGAGAACTAAACTCAGCCTATGCTTTGATCGCCAAAATTTGTTTAACATGAAGAAGAAGGAACAGAGAAAATGA

Reverse complement sequence

TCATTTTCTCTGTTCCTTCTTCTTCATGTTAAACAAATTTTGGCGATCAAAGCATAGGCTGAGTTTAGTTCTCAACTTTTTCTTCAAACTTTTAACTTTT[T/C]
CATCACATCGAAACTTTCCTACGCACACAAATTTTTAATTTTTCCATCACATCGTTTCAATTTCAATCAAACTTCCAATTTTGGCGTAAACTAAACACAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 43.20% 0.08% 0.00% NA
All Indica  2759 69.40% 30.60% 0.07% 0.00% NA
All Japonica  1512 32.00% 67.90% 0.07% 0.00% NA
Aus  269 63.90% 36.10% 0.00% 0.00% NA
Indica I  595 48.60% 51.30% 0.17% 0.00% NA
Indica II  465 42.60% 57.40% 0.00% 0.00% NA
Indica III  913 96.30% 3.70% 0.00% 0.00% NA
Indica Intermediate  786 69.70% 30.20% 0.13% 0.00% NA
Temperate Japonica  767 37.50% 62.50% 0.00% 0.00% NA
Tropical Japonica  504 27.60% 72.20% 0.20% 0.00% NA
Japonica Intermediate  241 23.70% 76.30% 0.00% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125547759 A -> G LOC_Os11g42450.1 upstream_gene_variant ; 4353.0bp to feature; MODIFIER silent_mutation Average:44.845; most accessible tissue: Callus, score: 73.239 N N N N
vg1125547759 A -> G LOC_Os11g42440.1 downstream_gene_variant ; 224.0bp to feature; MODIFIER silent_mutation Average:44.845; most accessible tissue: Callus, score: 73.239 N N N N
vg1125547759 A -> G LOC_Os11g42440-LOC_Os11g42450 intergenic_region ; MODIFIER silent_mutation Average:44.845; most accessible tissue: Callus, score: 73.239 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125547759 4.24E-06 NA mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 3.77E-09 6.29E-15 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 3.32E-17 1.04E-27 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 8.81E-19 1.49E-21 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 NA 6.49E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 1.83E-20 3.90E-35 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 3.18E-25 2.09E-29 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 5.16E-07 NA mr1667 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 8.11E-07 1.17E-09 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 NA 4.65E-06 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 NA 6.91E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 6.14E-06 2.60E-11 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 2.79E-21 2.15E-37 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 5.76E-24 1.39E-29 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 NA 7.20E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 NA 1.96E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 NA 6.81E-08 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125547759 NA 3.56E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251