\
| Variant ID: vg1125545839 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25545839 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 115. )
TGATCATTCATGGCGGCGTGCGTGTCCGCGTGATCCACCGCGTGTCATCGTCTCTGCAGGCCAGGCCGTTCCTGTACGGAGGAGGCGGTGATGGCGACGA[T/C]
GATGACGACGACGCGGTGAGGATGATGGTGGATCCTGCTCTCGGCGGCCAGTACGACGCCGGGCAGCTCGCCGTCGTCGCCTACGCCGCCAAGATCTGCA
TGCAGATCTTGGCGGCGTAGGCGACGACGGCGAGCTGCCCGGCGTCGTACTGGCCGCCGAGAGCAGGATCCACCATCATCCTCACCGCGTCGTCGTCATC[A/G]
TCGTCGCCATCACCGCCTCCTCCGTACAGGAACGGCCTGGCCTGCAGAGACGATGACACGCGGTGGATCACGCGGACACGCACGCCGCCATGAATGATCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.50% | 12.40% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 85.30% | 14.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 67.70% | 32.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 67.40% | 32.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.20% | 9.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 20.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125545839 | T -> C | LOC_Os11g42440.1 | synonymous_variant ; p.Asp479Asp; LOW | synonymous_codon | Average:66.941; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125545839 | 1.81E-37 | 1.15E-47 | mr1191 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | 2.51E-21 | 3.55E-25 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | NA | 3.07E-06 | mr1530 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | 3.08E-41 | 1.34E-56 | mr1644 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | 3.69E-23 | 5.05E-28 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | 3.53E-10 | 4.04E-18 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | 8.78E-08 | 1.65E-11 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | NA | 1.99E-06 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | 6.95E-59 | 2.51E-75 | mr1191_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | 2.28E-33 | 3.29E-44 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | NA | 4.37E-08 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | NA | 2.80E-07 | mr1530_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | 6.30E-13 | 3.25E-26 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | 2.22E-07 | 3.49E-13 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545839 | NA | 2.46E-10 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |