\
| Variant ID: vg1125545040 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25545040 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAGTAGGTCCCAAAAAAGTAAATAATAATCCCAAAATTTTTTGAATAAGACGAGTGGTCAAAAAGTGTAAGCAAAAACTTAAAATCCCTTATATTATGG[G/A]
ACGGAGGGAGTACTTTCTTAGCCTTAGGCCATCCTAAATATCATCTAACTATGTTACATTATGGTCAAATATTTTCTAGTCTTCATACCACAATTTATCT
AGATAAATTGTGGTATGAAGACTAGAAAATATTTGACCATAATGTAACATAGTTAGATGATATTTAGGATGGCCTAAGGCTAAGAAAGTACTCCCTCCGT[C/T]
CCATAATATAAGGGATTTTAAGTTTTTGCTTACACTTTTTGACCACTCGTCTTATTCAAAAAATTTTGGGATTATTATTTACTTTTTTGGGACCTACTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 6.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 97.00% | 2.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.60% | 4.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 2.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125545040 | G -> A | LOC_Os11g42430.1 | upstream_gene_variant ; 4588.0bp to feature; MODIFIER | silent_mutation | Average:34.352; most accessible tissue: Callus, score: 57.732 | N | N | N | N |
| vg1125545040 | G -> A | LOC_Os11g42440.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.352; most accessible tissue: Callus, score: 57.732 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125545040 | 1.91E-11 | NA | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545040 | 1.25E-09 | 4.21E-09 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545040 | 3.21E-06 | 3.20E-06 | mr1644 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545040 | 1.46E-13 | NA | mr1191_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545040 | 4.97E-08 | 4.97E-08 | mr1191_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125545040 | NA | 4.08E-06 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |