\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125545040:

Variant ID: vg1125545040 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25545040
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGTAGGTCCCAAAAAAGTAAATAATAATCCCAAAATTTTTTGAATAAGACGAGTGGTCAAAAAGTGTAAGCAAAAACTTAAAATCCCTTATATTATGG[G/A]
ACGGAGGGAGTACTTTCTTAGCCTTAGGCCATCCTAAATATCATCTAACTATGTTACATTATGGTCAAATATTTTCTAGTCTTCATACCACAATTTATCT

Reverse complement sequence

AGATAAATTGTGGTATGAAGACTAGAAAATATTTGACCATAATGTAACATAGTTAGATGATATTTAGGATGGCCTAAGGCTAAGAAAGTACTCCCTCCGT[C/T]
CCATAATATAAGGGATTTTAAGTTTTTGCTTACACTTTTTGACCACTCGTCTTATTCAAAAAATTTTGGGATTATTATTTACTTTTTTGGGACCTACTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 6.90% 0.04% 0.00% NA
All Indica  2759 97.00% 2.90% 0.07% 0.00% NA
All Japonica  1512 92.70% 7.30% 0.00% 0.00% NA
Aus  269 72.90% 27.10% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 95.60% 4.30% 0.11% 0.00% NA
Indica Intermediate  786 97.20% 2.70% 0.13% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 84.30% 15.70% 0.00% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125545040 G -> A LOC_Os11g42430.1 upstream_gene_variant ; 4588.0bp to feature; MODIFIER silent_mutation Average:34.352; most accessible tissue: Callus, score: 57.732 N N N N
vg1125545040 G -> A LOC_Os11g42440.1 intron_variant ; MODIFIER silent_mutation Average:34.352; most accessible tissue: Callus, score: 57.732 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125545040 1.91E-11 NA mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125545040 1.25E-09 4.21E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125545040 3.21E-06 3.20E-06 mr1644 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125545040 1.46E-13 NA mr1191_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125545040 4.97E-08 4.97E-08 mr1191_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125545040 NA 4.08E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251