Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125544943:

Variant ID: vg1125544943 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25544943
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGAGTTTTTGCTTATAATGTTTGACCACTCGTCTTATTCAAAAAATTTATGCAAATATAAAAAACGAAAAGTTGTACGTAAAGTACTTTGGATAATAAA[G/A]
TAGGTCCCAAAAAAGTAAATAATAATCCCAAAATTTTTTGAATAAGACGAGTGGTCAAAAAGTGTAAGCAAAAACTTAAAATCCCTTATATTATGGGACG

Reverse complement sequence

CGTCCCATAATATAAGGGATTTTAAGTTTTTGCTTACACTTTTTGACCACTCGTCTTATTCAAAAAATTTTGGGATTATTATTTACTTTTTTGGGACCTA[C/T]
TTTATTATCCAAAGTACTTTACGTACAACTTTTCGTTTTTTATATTTGCATAAATTTTTTGAATAAGACGAGTGGTCAAACATTATAAGCAAAAACTCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.40%	4.50%	0.72%	0.38%	NA
All Indica	2759	96.00%	2.20%	1.12%	0.65%	NA
All Japonica	1512	98.50%	1.40%	0.07%	0.00%	NA
Aus	269	73.20%	26.80%	0.00%	0.00%	NA
Indica I	595	97.10%	1.50%	1.18%	0.17%	NA
Indica II	465	99.10%	0.60%	0.22%	0.00%	NA
Indica III	913	94.30%	3.50%	0.99%	1.20%	NA
Indica Intermediate	786	95.20%	2.30%	1.78%	0.76%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.50%	0.41%	0.00%	NA
VI/Aromatic	96	44.80%	55.20%	0.00%	0.00%	NA
Intermediate	90	91.10%	6.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125544943	G -> A	LOC_Os11g42430.1	upstream_gene_variant ; 4491.0bp to feature; MODIFIER	silent_mutation	Average:36.751; most accessible tissue: Callus, score: 57.732	N	N	N	N
vg1125544943	G -> A	LOC_Os11g42440.1	intron_variant ; MODIFIER	silent_mutation	Average:36.751; most accessible tissue: Callus, score: 57.732	N	N	N	N
vg1125544943	G -> DEL	N	N	silent_mutation	Average:36.751; most accessible tissue: Callus, score: 57.732	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125544943	1.61E-15	5.14E-12	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125544943	1.30E-14	1.11E-14	mr1644	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125544943	NA	1.91E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125544943	4.91E-19	NA	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125544943	NA	2.61E-06	mr1465_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125544943	NA	3.70E-07	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125544943	NA	2.01E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125544943	1.64E-07	7.05E-12	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251