Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125524321:

Variant ID: vg1125524321 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25524321
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGACCATGGCACGCCGCCGCCCCTCGACCTTCGCGAGCTCCTCTTCGCACACCGCCGCCGCTCCTCCTCCGTCACCAGATCCGTAGTCCTCCCTATCG[C/T]
TGGATCCACCGCTGCAGTCCTCCTCATCGCTAGATCCGCCACCACCGTCCTCCCCACCACTGGATTTGCCATCGCCGAGTCCCCCACCATCGTCGTCGCC

Reverse complement sequence

GGCGACGACGATGGTGGGGGACTCGGCGATGGCAAATCCAGTGGTGGGGAGGACGGTGGTGGCGGATCTAGCGATGAGGAGGACTGCAGCGGTGGATCCA[G/A]
CGATAGGGAGGACTACGGATCTGGTGACGGAGGAGGAGCGGCGGCGGTGTGCGAAGAGGAGCTCGCGAAGGTCGAGGGGCGGCGGCGTGCCATGGTCATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 10.90% 0.15% 10.77% NA
All Indica  2759 68.90% 18.00% 0.07% 13.05% NA
All Japonica  1512 97.20% 1.10% 0.07% 1.65% NA
Aus  269 76.20% 0.00% 0.37% 23.42% NA
Indica I  595 63.00% 5.40% 0.00% 31.60% NA
Indica II  465 82.20% 1.10% 0.43% 16.34% NA
Indica III  913 65.80% 31.00% 0.00% 3.18% NA
Indica Intermediate  786 69.10% 22.40% 0.00% 8.52% NA
Temperate Japonica  767 96.00% 1.60% 0.00% 2.48% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 96.70% 1.20% 0.41% 1.66% NA
VI/Aromatic  96 49.00% 0.00% 2.08% 48.96% NA
Intermediate  90 78.90% 4.40% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125524321 C -> T LOC_Os11g42410.1 missense_variant ; p.Ser88Asn; MODERATE nonsynonymous_codon ; S88N Average:81.467; most accessible tissue: Minghui63 panicle, score: 91.227 unknown unknown TOLERATED 0.45
vg1125524321 C -> DEL LOC_Os11g42410.1 N frameshift_variant Average:81.467; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125524321 C T -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125524321 NA 1.60E-09 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125524321 NA 2.14E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125524321 NA 4.55E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125524321 5.63E-07 1.25E-16 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125524321 6.17E-06 1.52E-11 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125524321 4.34E-06 1.06E-11 mr1667_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125524321 4.65E-06 9.66E-10 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251