\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125521509:

Variant ID: vg1125521509 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25521509
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, T: 0.47, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGATAAAAAGTAATGGCGTCCGACTTATAAAACAGGGACTATATACCAACGACTGAAATTTATTCATTTCTTTATTTTAAAACAGGGACTATGTCCAA[C/T]
TTATGTACAATACCGGTTTGTTCCGTCTTACGTAATGAAAATAGCATGTGTGCGGCTTCTTTTTTTCCTTACGTCATTGATCTGTTGGAGCTTGCACTTT

Reverse complement sequence

AAAGTGCAAGCTCCAACAGATCAATGACGTAAGGAAAAAAAGAAGCCGCACACATGCTATTTTCATTACGTAAGACGGAACAAACCGGTATTGTACATAA[G/A]
TTGGACATAGTCCCTGTTTTAAAATAAAGAAATGAATAAATTTCAGTCGTTGGTATATAGTCCCTGTTTTATAAGTCGGACGCCATTACTTTTTATCTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 37.40% 0.13% 0.00% NA
All Indica  2759 45.80% 54.00% 0.18% 0.00% NA
All Japonica  1512 87.20% 12.80% 0.00% 0.00% NA
Aus  269 79.90% 19.70% 0.37% 0.00% NA
Indica I  595 87.20% 12.40% 0.34% 0.00% NA
Indica II  465 76.80% 23.00% 0.22% 0.00% NA
Indica III  913 8.00% 92.00% 0.00% 0.00% NA
Indica Intermediate  786 40.10% 59.70% 0.25% 0.00% NA
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 71.80% 28.20% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 12.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125521509 C -> T LOC_Os11g42400.1 downstream_gene_variant ; 1600.0bp to feature; MODIFIER silent_mutation Average:48.224; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg1125521509 C -> T LOC_Os11g42410.1 downstream_gene_variant ; 1138.0bp to feature; MODIFIER silent_mutation Average:48.224; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg1125521509 C -> T LOC_Os11g42400-LOC_Os11g42410 intergenic_region ; MODIFIER silent_mutation Average:48.224; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125521509 NA 1.73E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125521509 NA 1.11E-08 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 4.72E-16 2.74E-36 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 1.71E-14 1.07E-29 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 NA 1.12E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 7.83E-06 NA mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 1.82E-07 1.82E-07 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 3.00E-17 6.54E-20 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 1.40E-10 3.36E-14 mr1662 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 NA 2.60E-06 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 2.98E-10 1.26E-18 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 5.71E-11 1.65E-17 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 8.13E-07 2.11E-07 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 NA 1.64E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 7.32E-17 1.14E-35 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 2.05E-14 2.43E-29 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 1.59E-13 1.06E-15 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 2.09E-07 7.28E-11 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 1.97E-06 1.17E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 2.28E-11 4.15E-21 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125521509 5.41E-11 5.94E-19 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251