Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125520645:

Variant ID: vg1125520645 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25520645
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCTTTTAGTATTTCTCTACTCTATTTATTACTCTTGAGTCTTTTCGTCCTAAAATATAAGAAGTTTTGGTTGGATTAGATATATCATAGAATACGAAT[C/T]
TGTATATGTTGTATGTCTAAATTCATAGTGTTAGGATGTGTCTCGTTCAACCAAAACTTCTTATATTTTGTGTCAAAGGGAGTAAATTTTATTTCCCTGC

Reverse complement sequence

GCAGGGAAATAAAATTTACTCCCTTTGACACAAAATATAAGAAGTTTTGGTTGAACGAGACACATCCTAACACTATGAATTTAGACATACAACATATACA[G/A]
ATTCGTATTCTATGATATATCTAATCCAACCAAAACTTCTTATATTTTAGGACGAAAAGACTCAAGAGTAATAAATAGAGTAGAGAAATACTAAAAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.90%	23.00%	0.13%	0.00%	NA
All Indica	2759	64.20%	35.70%	0.18%	0.00%	NA
All Japonica	1512	97.20%	2.80%	0.00%	0.00%	NA
Aus	269	84.40%	15.60%	0.00%	0.00%	NA
Indica I	595	92.30%	7.60%	0.17%	0.00%	NA
Indica II	465	79.10%	20.90%	0.00%	0.00%	NA
Indica III	913	39.50%	60.50%	0.00%	0.00%	NA
Indica Intermediate	786	62.60%	36.90%	0.51%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	92.90%	7.10%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125520645	C -> T	LOC_Os11g42390.1	downstream_gene_variant ; 4927.0bp to feature; MODIFIER	silent_mutation	Average:36.024; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg1125520645	C -> T	LOC_Os11g42400.1	downstream_gene_variant ; 736.0bp to feature; MODIFIER	silent_mutation	Average:36.024; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg1125520645	C -> T	LOC_Os11g42410.1	downstream_gene_variant ; 2002.0bp to feature; MODIFIER	silent_mutation	Average:36.024; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg1125520645	C -> T	LOC_Os11g42400-LOC_Os11g42410	intergenic_region ; MODIFIER	silent_mutation	Average:36.024; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125520645	NA	5.47E-07	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	1.95E-07	3.48E-21	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	6.30E-09	4.96E-17	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	6.29E-06	NA	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	5.45E-07	5.45E-07	mr1540	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	1.04E-11	7.17E-13	mr1644	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	7.03E-11	1.29E-09	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	2.67E-07	9.44E-11	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	NA	1.24E-09	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	NA	3.59E-08	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	6.79E-06	3.54E-07	mr1732	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	NA	2.11E-06	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	NA	1.86E-17	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	NA	1.45E-12	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	9.78E-06	NA	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	NA	4.06E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	4.52E-07	2.93E-09	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	NA	8.80E-09	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	NA	5.66E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125520645	NA	7.89E-08	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251