\
| Variant ID: vg1125514201 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25514201 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 117. )
TGCAGAGTTAGTGTACCTTCATTAATTAATTTGTTGATTAATACTAATTTTCCTTTTCTTCTTCTACTACTCCAGTATATATATATCATCATTTATATCT[T/G]
ACATGCCTGCCATTTGGCATTTCTTCTTATCAGACAGCAAGATATACCATGTCCAGAATATGGGCAAACAATGACACAGTAAGAGAGGCACTTGGAATAC
GTATTCCAAGTGCCTCTCTTACTGTGTCATTGTTTGCCCATATTCTGGACATGGTATATCTTGCTGTCTGATAAGAAGAAATGCCAAATGGCAGGCATGT[A/C]
AGATATAAATGATGATATATATATACTGGAGTAGTAGAAGAAGAAAAGGAAAATTAGTATTAATCAACAAATTAATTAATGAAGGTACACTAACTCTGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.70% | 35.90% | 0.30% | 1.08% | NA |
| All Indica | 2759 | 46.10% | 51.70% | 0.40% | 1.78% | NA |
| All Japonica | 1512 | 87.20% | 12.70% | 0.00% | 0.13% | NA |
| Aus | 269 | 80.70% | 18.20% | 1.12% | 0.00% | NA |
| Indica I | 595 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 77.00% | 22.40% | 0.22% | 0.43% | NA |
| Indica III | 913 | 8.20% | 87.80% | 0.22% | 3.72% | NA |
| Indica Intermediate | 786 | 40.70% | 56.60% | 1.02% | 1.65% | NA |
| Temperate Japonica | 767 | 97.30% | 2.50% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 71.60% | 28.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125514201 | T -> DEL | N | N | silent_mutation | Average:61.768; most accessible tissue: Callus, score: 81.916 | N | N | N | N |
| vg1125514201 | T -> G | LOC_Os11g42400.1 | upstream_gene_variant ; 4957.0bp to feature; MODIFIER | silent_mutation | Average:61.768; most accessible tissue: Callus, score: 81.916 | N | N | N | N |
| vg1125514201 | T -> G | LOC_Os11g42390.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.768; most accessible tissue: Callus, score: 81.916 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125514201 | NA | 1.04E-09 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1125514201 | NA | 7.93E-08 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 4.58E-14 | 8.34E-32 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 9.12E-14 | 2.28E-25 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 1.47E-06 | 1.47E-06 | mr1540 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 4.36E-17 | 9.20E-21 | mr1662 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 2.37E-10 | 1.03E-14 | mr1662 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | NA | 2.36E-06 | mr1662 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 5.59E-10 | 7.96E-18 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 4.11E-10 | 9.31E-16 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | NA | 1.94E-06 | mr1732 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 1.94E-14 | 1.42E-31 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 3.95E-12 | 6.71E-25 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 6.01E-14 | 1.77E-16 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 4.43E-08 | 1.39E-11 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | NA | 3.57E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 6.17E-10 | 9.47E-19 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125514201 | 5.11E-10 | 8.43E-17 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |