\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125509643:

Variant ID: vg1125509643 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 25509643
Reference Allele: TCTCCTCCTCAlternative Allele: GCTCCTCCTC,TCTCCTC,CCTCCTCCTC,TCTCCTCCTCCTCCTCCTCCTC,T
Primary Allele: TCTCCTCCTCSecondary Allele: GCTCCTCCTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTAATTAGCTAGCTGAAGCTTAAGCTGCAGCTGTTTTTCTTCATGAATTTATGTACAGAGCAGCCGGCGGTAACACGGCGGCAGCTGCTGCTGCTGCT[TCTCCTCCTC/GCTCCTCCTC,TCTCCTC,CCTCCTCCTC,TCTCCTCCTCCTCCTCCTCCTC,T]
CTCCTCCTCCTCACCTCCTCTCCTCTCTGCAGCCGCGTGTCCGCGAGTGCGGGTGCGAGAGCGAGAAGCAATGGCGGCGGCAGCAGCAGGAGAGTGGTGA

Reverse complement sequence

TCACCACTCTCCTGCTGCTGCCGCCGCCATTGCTTCTCGCTCTCGCACCCGCACTCGCGGACACGCGGCTGCAGAGAGGAGAGGAGGTGAGGAGGAGGAG[GAGGAGGAGA/GAGGAGGAGC,GAGGAGA,GAGGAGGAGG,GAGGAGGAGGAGGAGGAGGAGA,A]
AGCAGCAGCAGCAGCTGCCGCCGTGTTACCGCCGGCTGCTCTGTACATAAATTCATGAAGAAAAACAGCTGCAGCTTAAGCTTCAGCTAGCTAATTAATT

Allele Frequencies:

Populations Population SizeFrequency of TCTCCTCCTC(primary allele) Frequency of GCTCCTCCTC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 6.60% 3.60% 29.41% TCTCCTC: 0.15%
All Indica  2759 42.00% 9.60% 3.81% 44.44% TCTCCTC: 0.11%
All Japonica  1512 87.00% 2.20% 2.65% 8.00% TCTCCTC: 0.13%
Aus  269 81.40% 2.60% 6.32% 8.92% TCTCCTC: 0.74%
Indica I  595 76.50% 1.80% 3.53% 18.15% NA
Indica II  465 70.30% 3.00% 1.72% 24.73% TCTCCTC: 0.22%
Indica III  913 8.50% 20.20% 4.60% 66.70% NA
Indica Intermediate  786 38.20% 7.10% 4.33% 50.13% TCTCCTC: 0.25%
Temperate Japonica  767 97.00% 0.30% 0.39% 2.35% NA
Tropical Japonica  504 71.40% 5.60% 5.16% 17.46% TCTCCTC: 0.40%
Japonica Intermediate  241 87.60% 1.70% 4.56% 6.22% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 63.30% 6.70% 8.89% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125509643 TCTCCTCCTC -> GCTCCTCCTC LOC_Os11g42390.1 synonymous_variant ; p.Leu19Leu; LOW synonymous_codon Average:83.52; most accessible tissue: Zhenshan97 root, score: 94.629 N N N N
vg1125509643 TCTCCTCCTC -> CCTCCTCCTC LOC_Os11g42390.1 synonymous_variant ; p.Leu19Leu; LOW N Average:83.52; most accessible tissue: Zhenshan97 root, score: 94.629 N N N N
vg1125509643 TCTCCTCCTC -> T LOC_Os11g42390.1 inframe_deletion ; p.Leu24_Leu26del; MODERATE N Average:83.52; most accessible tissue: Zhenshan97 root, score: 94.629 N N N N
vg1125509643 TCTCCTCCTC -> DEL LOC_Os11g42390.1 N frameshift_variant Average:83.52; most accessible tissue: Zhenshan97 root, score: 94.629 N N N N
vg1125509643 TCTCCTCCTC -> TCTCCTC LOC_Os11g42390.1 inframe_deletion ; p.Leu26del; MODERATE inframe_variant Average:83.52; most accessible tissue: Zhenshan97 root, score: 94.629 N N N N
vg1125509643 TCTCCTCCTC -> TCTCCTCCTCCTCCTCCTCCTC LOC_Os11g42390.1 inframe_insertion ; p.Leu23_Leu26dup; MODERATE N Average:83.52; most accessible tissue: Zhenshan97 root, score: 94.629 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125509643 TCTCC* CCTCC* -0.04 -0.02 -0.05 -0.03 -0.04 -0.04
vg1125509643 TCTCC* GCTCC* -0.07 -0.02 -0.03 -0.02 -0.03 -0.03
vg1125509643 TCTCC* T -0.15 -0.07 -0.02 -0.15 -0.2 -0.16
vg1125509643 TCTCC* TCTCC* 0.04 -0.01 0.06 -0.06 -0.02 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125509643 NA 2.63E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125509643 NA 1.54E-09 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 7.50E-17 8.34E-37 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 4.71E-16 1.92E-30 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 NA 8.66E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 NA 2.75E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 1.24E-07 1.12E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 6.86E-09 6.86E-09 mr1540 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 6.04E-15 1.10E-18 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 5.02E-08 3.13E-12 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 8.49E-06 6.47E-07 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 2.75E-10 2.20E-18 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 4.47E-10 3.94E-16 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 1.71E-07 7.21E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 2.39E-08 8.59E-09 mr1732 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 NA 3.03E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 NA 1.33E-06 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 3.00E-16 2.03E-35 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 1.63E-14 1.65E-29 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 7.06E-13 2.33E-15 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 4.26E-06 8.33E-10 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 6.40E-07 2.55E-07 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 3.82E-12 1.20E-21 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125509643 7.75E-13 1.82E-20 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251