Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125505436:

Variant ID: vg1125505436 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25505436
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.10, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTATCTTGGTTATGCTCAGACCGAGTCATGCCAGACAGACCATTTAGCCATCTACAGTAGCCACAAACTCTAAAAGACCATCACCGGTGAGGAGCTCC[A/G]
CCTCTGTCACCATCTTCTTTGCAAGCCGGGAGGGTCAGGGTGCGCCAAGGAAGCTGAAGCGCCGCTAGCTATTGATGCCTAGAACCCACTTGGTCGGCTG

Reverse complement sequence

CAGCCGACCAAGTGGGTTCTAGGCATCAATAGCTAGCGGCGCTTCAGCTTCCTTGGCGCACCCTGACCCTCCCGGCTTGCAAAGAAGATGGTGACAGAGG[T/C]
GGAGCTCCTCACCGGTGATGGTCTTTTAGAGTTTGTGGCTACTGTAGATGGCTAAATGGTCTGTCTGGCATGACTCGGTCTGAGCATAACCAAGATACGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.00% 10.20% 0.28% 4.53% NA
All Indica  2759 76.00% 15.90% 0.43% 7.58% NA
All Japonica  1512 98.30% 1.40% 0.00% 0.26% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 70.40% 28.70% 0.84% 0.00% NA
Indica II  465 64.10% 34.00% 0.43% 1.51% NA
Indica III  913 82.80% 0.40% 0.33% 16.43% NA
Indica Intermediate  786 79.50% 13.60% 0.25% 6.62% NA
Temperate Japonica  767 98.80% 0.90% 0.00% 0.26% NA
Tropical Japonica  504 97.20% 2.60% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 10.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125505436 A -> DEL N N silent_mutation Average:78.455; most accessible tissue: Callus, score: 99.047 N N N N
vg1125505436 A -> G LOC_Os11g42380.1 upstream_gene_variant ; 1408.0bp to feature; MODIFIER silent_mutation Average:78.455; most accessible tissue: Callus, score: 99.047 N N N N
vg1125505436 A -> G LOC_Os11g42390.1 upstream_gene_variant ; 4151.0bp to feature; MODIFIER silent_mutation Average:78.455; most accessible tissue: Callus, score: 99.047 N N N N
vg1125505436 A -> G LOC_Os11g42370.1 downstream_gene_variant ; 2267.0bp to feature; MODIFIER silent_mutation Average:78.455; most accessible tissue: Callus, score: 99.047 N N N N
vg1125505436 A -> G LOC_Os11g42380-LOC_Os11g42390 intergenic_region ; MODIFIER silent_mutation Average:78.455; most accessible tissue: Callus, score: 99.047 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125505436 A G 0.03 0.02 0.03 0.02 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125505436 2.63E-11 1.94E-17 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 1.62E-11 8.09E-14 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 2.05E-09 2.71E-15 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 7.33E-10 5.16E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 4.25E-12 2.01E-12 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 2.97E-11 1.40E-13 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 NA 6.05E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 NA 9.54E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 NA 7.19E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 4.44E-17 3.31E-31 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 7.27E-16 9.72E-22 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 1.10E-09 4.36E-14 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 2.81E-11 8.42E-16 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 NA 1.97E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125505436 NA 5.37E-10 mr1929_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251