\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125504134:

Variant ID: vg1125504134 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25504134
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, T: 0.14, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTCGTGATTTTCATATATGTACGTGGTTTTTGTGCACTATATTATAGCGTAGCTCAACTGACTATGTTCCTTGGGGTTTAACCAGCCCTCCAGACACA[T/G]
GTGTGTTCGTATTTATAACTAATTATTCTTTCAATGATAAGTCATGTACCCAATGTCTGCGGTGACTTCATCAATCTTTTATATGCTTATAGAATAGGGT

Reverse complement sequence

ACCCTATTCTATAAGCATATAAAAGATTGATGAAGTCACCGCAGACATTGGGTACATGACTTATCATTGAAAGAATAATTAGTTATAAATACGAACACAC[A/C]
TGTGTCTGGAGGGCTGGTTAAACCCCAAGGAACATAGTCAGTTGAGCTACGCTATAATATAGTGCACAAAAACCACGTACATATATGAAAATCACGAGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 28.00% 7.96% 1.76% NA
All Indica  2759 61.90% 22.10% 12.94% 2.97% NA
All Japonica  1512 64.50% 34.70% 0.73% 0.07% NA
Aus  269 58.40% 40.90% 0.74% 0.00% NA
Indica I  595 52.10% 44.70% 3.19% 0.00% NA
Indica II  465 59.10% 36.10% 4.30% 0.43% NA
Indica III  913 66.30% 4.40% 22.89% 6.46% NA
Indica Intermediate  786 66.00% 17.40% 13.87% 2.67% NA
Temperate Japonica  767 84.50% 15.00% 0.52% 0.00% NA
Tropical Japonica  504 37.30% 61.70% 0.99% 0.00% NA
Japonica Intermediate  241 57.70% 41.10% 0.83% 0.41% NA
VI/Aromatic  96 45.80% 54.20% 0.00% 0.00% NA
Intermediate  90 63.30% 30.00% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125504134 T -> DEL N N silent_mutation Average:58.661; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1125504134 T -> G LOC_Os11g42380.1 upstream_gene_variant ; 106.0bp to feature; MODIFIER silent_mutation Average:58.661; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1125504134 T -> G LOC_Os11g42370.1 downstream_gene_variant ; 965.0bp to feature; MODIFIER silent_mutation Average:58.661; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg1125504134 T -> G LOC_Os11g42380-LOC_Os11g42390 intergenic_region ; MODIFIER silent_mutation Average:58.661; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125504134 NA 5.62E-09 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125504134 2.42E-14 4.97E-19 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125504134 1.11E-12 9.82E-16 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125504134 NA 1.35E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125504134 2.50E-18 6.55E-26 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125504134 3.39E-14 7.44E-19 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125504134 NA 1.34E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125504134 NA 4.61E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125504134 NA 9.01E-08 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125504134 3.55E-13 4.20E-24 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125504134 1.36E-12 1.74E-19 mr1191_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125504134 NA 4.95E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251