Variant ID: vg1125504134 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 25504134 |
Reference Allele: T | Alternative Allele: G |
Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, T: 0.14, others allele: 0.00, population size: 94. )
TCCTCGTGATTTTCATATATGTACGTGGTTTTTGTGCACTATATTATAGCGTAGCTCAACTGACTATGTTCCTTGGGGTTTAACCAGCCCTCCAGACACA[T/G]
GTGTGTTCGTATTTATAACTAATTATTCTTTCAATGATAAGTCATGTACCCAATGTCTGCGGTGACTTCATCAATCTTTTATATGCTTATAGAATAGGGT
ACCCTATTCTATAAGCATATAAAAGATTGATGAAGTCACCGCAGACATTGGGTACATGACTTATCATTGAAAGAATAATTAGTTATAAATACGAACACAC[A/C]
TGTGTCTGGAGGGCTGGTTAAACCCCAAGGAACATAGTCAGTTGAGCTACGCTATAATATAGTGCACAAAAACCACGTACATATATGAAAATCACGAGGA
Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 62.30% | 28.00% | 7.96% | 1.76% | NA |
All Indica | 2759 | 61.90% | 22.10% | 12.94% | 2.97% | NA |
All Japonica | 1512 | 64.50% | 34.70% | 0.73% | 0.07% | NA |
Aus | 269 | 58.40% | 40.90% | 0.74% | 0.00% | NA |
Indica I | 595 | 52.10% | 44.70% | 3.19% | 0.00% | NA |
Indica II | 465 | 59.10% | 36.10% | 4.30% | 0.43% | NA |
Indica III | 913 | 66.30% | 4.40% | 22.89% | 6.46% | NA |
Indica Intermediate | 786 | 66.00% | 17.40% | 13.87% | 2.67% | NA |
Temperate Japonica | 767 | 84.50% | 15.00% | 0.52% | 0.00% | NA |
Tropical Japonica | 504 | 37.30% | 61.70% | 0.99% | 0.00% | NA |
Japonica Intermediate | 241 | 57.70% | 41.10% | 0.83% | 0.41% | NA |
VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 63.30% | 30.00% | 6.67% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1125504134 | T -> DEL | N | N | silent_mutation | Average:58.661; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
vg1125504134 | T -> G | LOC_Os11g42380.1 | upstream_gene_variant ; 106.0bp to feature; MODIFIER | silent_mutation | Average:58.661; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
vg1125504134 | T -> G | LOC_Os11g42370.1 | downstream_gene_variant ; 965.0bp to feature; MODIFIER | silent_mutation | Average:58.661; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
vg1125504134 | T -> G | LOC_Os11g42380-LOC_Os11g42390 | intergenic_region ; MODIFIER | silent_mutation | Average:58.661; most accessible tissue: Zhenshan97 panicle, score: 85.665 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1125504134 | NA | 5.62E-09 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125504134 | 2.42E-14 | 4.97E-19 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125504134 | 1.11E-12 | 9.82E-16 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125504134 | NA | 1.35E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125504134 | 2.50E-18 | 6.55E-26 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125504134 | 3.39E-14 | 7.44E-19 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125504134 | NA | 1.34E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125504134 | NA | 4.61E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125504134 | NA | 9.01E-08 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125504134 | 3.55E-13 | 4.20E-24 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125504134 | 1.36E-12 | 1.74E-19 | mr1191_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125504134 | NA | 4.95E-06 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |