\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125494322:

Variant ID: vg1125494322 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25494322
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TAACCTGATTAGTAGTATTGTTTTGCTAACTACAGGACCCTACTTAATCGACATGGCAAGGTTTTAGGCCTTGATTCCAAAAGGATTCCTCAGAACTGGG[C/T]
TGCCACCCAATTTGCTGAAGCATTGAGCATGGCTTGGACTGAGTTTAATAACAAGAGGTCTAAACTTTACCTATGCACTATGAGTTTGTGTTAATTCAGT

Reverse complement sequence

ACTGAATTAACACAAACTCATAGTGCATAGGTAAAGTTTAGACCTCTTGTTATTAAACTCAGTCCAAGCCATGCTCAATGCTTCAGCAAATTGGGTGGCA[G/A]
CCCAGTTCTGAGGAATCCTTTTGGAATCAAGGCCTAAAACCTTGCCATGTCGATTAAGTAGGGTCCTGTAGTTAGCAAAACAATACTACTAATCAGGTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 36.90% 0.23% 0.04% NA
All Indica  2759 45.80% 53.90% 0.29% 0.07% NA
All Japonica  1512 87.20% 12.60% 0.13% 0.00% NA
Aus  269 85.10% 14.90% 0.00% 0.00% NA
Indica I  595 86.10% 13.40% 0.50% 0.00% NA
Indica II  465 77.20% 22.40% 0.43% 0.00% NA
Indica III  913 8.10% 91.60% 0.11% 0.22% NA
Indica Intermediate  786 40.50% 59.30% 0.25% 0.00% NA
Temperate Japonica  767 97.30% 2.60% 0.13% 0.00% NA
Tropical Japonica  504 72.00% 28.00% 0.00% 0.00% NA
Japonica Intermediate  241 87.10% 12.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125494322 C -> T LOC_Os11g42350.1 missense_variant ; p.Ala249Val; MODERATE nonsynonymous_codon ; A249V Average:46.532; most accessible tissue: Zhenshan97 young leaf, score: 64.205 benign 0.399 DELETERIOUS 0.04
vg1125494322 C -> T LOC_Os11g42350.2 missense_variant ; p.Ala249Val; MODERATE nonsynonymous_codon ; A249V Average:46.532; most accessible tissue: Zhenshan97 young leaf, score: 64.205 benign 0.399 DELETERIOUS 0.04
vg1125494322 C -> T LOC_Os11g42350.3 missense_variant ; p.Ala249Val; MODERATE nonsynonymous_codon ; A249V Average:46.532; most accessible tissue: Zhenshan97 young leaf, score: 64.205 benign 0.399 DELETERIOUS 0.04
vg1125494322 C -> DEL LOC_Os11g42350.2 N frameshift_variant Average:46.532; most accessible tissue: Zhenshan97 young leaf, score: 64.205 N N N N
vg1125494322 C -> DEL LOC_Os11g42350.1 N frameshift_variant Average:46.532; most accessible tissue: Zhenshan97 young leaf, score: 64.205 N N N N
vg1125494322 C -> DEL LOC_Os11g42350.3 N frameshift_variant Average:46.532; most accessible tissue: Zhenshan97 young leaf, score: 64.205 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125494322 NA 1.78E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125494322 NA 4.44E-10 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 5.73E-20 1.00E-40 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 7.43E-19 4.41E-34 mr1133 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 NA 2.17E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 3.07E-07 2.09E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 9.53E-08 9.54E-08 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 6.09E-15 2.21E-18 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 2.92E-08 3.09E-12 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 NA 2.60E-06 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 1.19E-11 3.12E-20 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 6.56E-12 1.52E-18 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 8.58E-07 NA mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 3.87E-07 1.16E-07 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 NA 1.17E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 NA 2.90E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 3.46E-19 3.44E-39 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 8.72E-17 2.10E-32 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 NA 1.44E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 8.65E-14 1.65E-15 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 5.19E-07 2.35E-10 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 1.97E-06 1.17E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 8.44E-12 1.43E-21 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494322 3.16E-12 4.52E-20 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251