\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125494245:

Variant ID: vg1125494245 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25494245
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, G: 0.09, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAGTTCCCTTGTAAGCGAACTTCACAGGTCAGGTTAATTTCTACAGATTTGCCTTGTTTTAATCTTCTAATGTGTTAACCTGATTAGTAGTATTGTTT[T/G]
GCTAACTACAGGACCCTACTTAATCGACATGGCAAGGTTTTAGGCCTTGATTCCAAAAGGATTCCTCAGAACTGGGCTGCCACCCAATTTGCTGAAGCAT

Reverse complement sequence

ATGCTTCAGCAAATTGGGTGGCAGCCCAGTTCTGAGGAATCCTTTTGGAATCAAGGCCTAAAACCTTGCCATGTCGATTAAGTAGGGTCCTGTAGTTAGC[A/C]
AAACAATACTACTAATCAGGTTAACACATTAGAAGATTAAAACAAGGCAAATCTGTAGAAATTAACCTGACCTGTGAAGTTCGCTTACAAGGGAACTAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 36.90% 0.17% 0.21% NA
All Indica  2759 45.70% 53.90% 0.11% 0.33% NA
All Japonica  1512 87.20% 12.60% 0.13% 0.07% NA
Aus  269 85.10% 14.90% 0.00% 0.00% NA
Indica I  595 86.10% 13.40% 0.17% 0.34% NA
Indica II  465 77.20% 22.60% 0.00% 0.22% NA
Indica III  913 7.90% 91.70% 0.00% 0.44% NA
Indica Intermediate  786 40.50% 59.00% 0.25% 0.25% NA
Temperate Japonica  767 97.30% 2.60% 0.00% 0.13% NA
Tropical Japonica  504 72.00% 27.80% 0.20% 0.00% NA
Japonica Intermediate  241 87.10% 12.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 66.70% 30.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125494245 T -> DEL N N silent_mutation Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg1125494245 T -> G LOC_Os11g42330.1 upstream_gene_variant ; 4754.0bp to feature; MODIFIER silent_mutation Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg1125494245 T -> G LOC_Os11g42360.1 upstream_gene_variant ; 3596.0bp to feature; MODIFIER silent_mutation Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg1125494245 T -> G LOC_Os11g42340.1 downstream_gene_variant ; 2626.0bp to feature; MODIFIER silent_mutation Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg1125494245 T -> G LOC_Os11g42350.1 intron_variant ; MODIFIER silent_mutation Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg1125494245 T -> G LOC_Os11g42350.2 intron_variant ; MODIFIER silent_mutation Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg1125494245 T -> G LOC_Os11g42350.3 intron_variant ; MODIFIER silent_mutation Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125494245 NA 9.99E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125494245 NA 1.87E-10 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 7.96E-20 8.13E-41 mr1133 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 1.17E-18 5.07E-34 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 NA 2.53E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 3.98E-07 2.20E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 1.10E-07 1.10E-07 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 2.42E-15 1.45E-18 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 1.25E-08 1.59E-12 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 NA 2.60E-06 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 1.71E-11 4.50E-20 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 1.01E-11 3.31E-18 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 1.49E-06 NA mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 7.04E-07 1.72E-07 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 NA 8.51E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 NA 2.87E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 8.69E-19 6.63E-39 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 2.53E-16 6.48E-32 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 NA 9.45E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 8.48E-14 2.10E-15 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 5.12E-07 2.39E-10 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 1.97E-06 1.17E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 8.14E-12 1.23E-21 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245 2.79E-12 4.67E-20 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251