Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125494245:

Variant ID: vg1125494245 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25494245
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, G: 0.09, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

CTTAGTTCCCTTGTAAGCGAACTTCACAGGTCAGGTTAATTTCTACAGATTTGCCTTGTTTTAATCTTCTAATGTGTTAACCTGATTAGTAGTATTGTTT[T/G]
GCTAACTACAGGACCCTACTTAATCGACATGGCAAGGTTTTAGGCCTTGATTCCAAAAGGATTCCTCAGAACTGGGCTGCCACCCAATTTGCTGAAGCAT

Reverse complement sequence

ATGCTTCAGCAAATTGGGTGGCAGCCCAGTTCTGAGGAATCCTTTTGGAATCAAGGCCTAAAACCTTGCCATGTCGATTAAGTAGGGTCCTGTAGTTAGC[A/C]
AAACAATACTACTAATCAGGTTAACACATTAGAAGATTAAAACAAGGCAAATCTGTAGAAATTAACCTGACCTGTGAAGTTCGCTTACAAGGGAACTAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	36.90%	0.17%	0.21%	NA
All Indica	2759	45.70%	53.90%	0.11%	0.33%	NA
All Japonica	1512	87.20%	12.60%	0.13%	0.07%	NA
Aus	269	85.10%	14.90%	0.00%	0.00%	NA
Indica I	595	86.10%	13.40%	0.17%	0.34%	NA
Indica II	465	77.20%	22.60%	0.00%	0.22%	NA
Indica III	913	7.90%	91.70%	0.00%	0.44%	NA
Indica Intermediate	786	40.50%	59.00%	0.25%	0.25%	NA
Temperate Japonica	767	97.30%	2.60%	0.00%	0.13%	NA
Tropical Japonica	504	72.00%	27.80%	0.20%	0.00%	NA
Japonica Intermediate	241	87.10%	12.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	66.70%	30.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125494245	T -> DEL	N	N	silent_mutation	Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg1125494245	T -> G	LOC_Os11g42330.1	upstream_gene_variant ; 4754.0bp to feature; MODIFIER	silent_mutation	Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg1125494245	T -> G	LOC_Os11g42360.1	upstream_gene_variant ; 3596.0bp to feature; MODIFIER	silent_mutation	Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg1125494245	T -> G	LOC_Os11g42340.1	downstream_gene_variant ; 2626.0bp to feature; MODIFIER	silent_mutation	Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg1125494245	T -> G	LOC_Os11g42350.1	intron_variant ; MODIFIER	silent_mutation	Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg1125494245	T -> G	LOC_Os11g42350.2	intron_variant ; MODIFIER	silent_mutation	Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg1125494245	T -> G	LOC_Os11g42350.3	intron_variant ; MODIFIER	silent_mutation	Average:48.109; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125494245	NA	9.99E-10	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125494245	NA	1.87E-10	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	7.96E-20	8.13E-41	mr1133	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	1.17E-18	5.07E-34	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	NA	2.53E-06	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	3.98E-07	2.20E-12	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	1.10E-07	1.10E-07	mr1540	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	2.42E-15	1.45E-18	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	1.25E-08	1.59E-12	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	NA	2.60E-06	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	1.71E-11	4.50E-20	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	1.01E-11	3.31E-18	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	1.49E-06	NA	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	7.04E-07	1.72E-07	mr1732	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	NA	8.51E-07	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	NA	2.87E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	8.69E-19	6.63E-39	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	2.53E-16	6.48E-32	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	NA	9.45E-07	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	8.48E-14	2.10E-15	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	5.12E-07	2.39E-10	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	1.97E-06	1.17E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	8.14E-12	1.23E-21	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125494245	2.79E-12	4.67E-20	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251