\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125492809:

Variant ID: vg1125492809 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25492809
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GCATTAGTCTGGAAATGCGGGAGAAAAATCATACACTATTTTTTACTGTCCCATTTTCAGTGTGTTGATCCCATCCGTGAATTGCTGAATCACTAAACCC[G/A]
GTATGCTCTACCAAGAGATTGTTATATATATATATATATAGTTTGTTGCTGTACACTACAGTGGTACATTCAGTCTACAACATCTTGTCTTGTGTGAAAT

Reverse complement sequence

ATTTCACACAAGACAAGATGTTGTAGACTGAATGTACCACTGTAGTGTACAGCAACAAACTATATATATATATATATAACAATCTCTTGGTAGAGCATAC[C/T]
GGGTTTAGTGATTCAGCAATTCACGGATGGGATCAACACACTGAAAATGGGACAGTAAAAAATAGTGTATGATTTTTCTCCCGCATTTCCAGACTAATGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 30.30% 4.46% 2.81% NA
All Indica  2759 45.70% 43.50% 6.49% 4.31% NA
All Japonica  1512 87.30% 10.40% 1.72% 0.53% NA
Aus  269 79.90% 19.70% 0.00% 0.37% NA
Indica I  595 86.20% 10.10% 3.19% 0.50% NA
Indica II  465 76.60% 17.60% 3.87% 1.94% NA
Indica III  913 8.00% 77.20% 6.24% 8.54% NA
Indica Intermediate  786 40.60% 44.90% 10.81% 3.69% NA
Temperate Japonica  767 97.30% 2.10% 0.65% 0.00% NA
Tropical Japonica  504 72.00% 23.00% 3.77% 1.19% NA
Japonica Intermediate  241 87.60% 10.80% 0.83% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 65.60% 22.20% 6.67% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125492809 G -> A LOC_Os11g42330.1 upstream_gene_variant ; 3318.0bp to feature; MODIFIER silent_mutation Average:71.041; most accessible tissue: Zhenshan97 flag leaf, score: 87.378 N N N N
vg1125492809 G -> A LOC_Os11g42340.1 downstream_gene_variant ; 1190.0bp to feature; MODIFIER silent_mutation Average:71.041; most accessible tissue: Zhenshan97 flag leaf, score: 87.378 N N N N
vg1125492809 G -> A LOC_Os11g42350.1 intron_variant ; MODIFIER silent_mutation Average:71.041; most accessible tissue: Zhenshan97 flag leaf, score: 87.378 N N N N
vg1125492809 G -> A LOC_Os11g42350.2 intron_variant ; MODIFIER silent_mutation Average:71.041; most accessible tissue: Zhenshan97 flag leaf, score: 87.378 N N N N
vg1125492809 G -> A LOC_Os11g42350.3 intron_variant ; MODIFIER silent_mutation Average:71.041; most accessible tissue: Zhenshan97 flag leaf, score: 87.378 N N N N
vg1125492809 G -> DEL N N silent_mutation Average:71.041; most accessible tissue: Zhenshan97 flag leaf, score: 87.378 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125492809 G A -0.02 -0.02 -0.03 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125492809 NA 3.89E-09 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 1.17E-19 2.93E-40 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 1.37E-19 1.79E-33 mr1133 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 NA 1.33E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 6.73E-06 NA mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 4.71E-08 4.71E-08 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 2.91E-13 1.05E-16 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 7.58E-08 4.96E-12 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 2.00E-10 6.93E-19 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 3.09E-11 1.95E-17 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 2.06E-07 5.78E-08 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 NA 7.94E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 NA 9.34E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 NA 7.57E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 2.73E-19 1.15E-38 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 3.94E-17 8.65E-32 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 1.29E-11 5.23E-14 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 1.63E-06 3.82E-10 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 8.55E-13 1.16E-22 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125492809 9.09E-13 2.53E-20 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251