Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125479021:

Variant ID: vg1125479021 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25479021
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAATTGGGCATAATTTATTCTCTTTTTGATAAAAGCCCATTAGTGCCCGACTCTTTTTTTTATCATATCTTATTAAGCCTGTTGTATTTGGTGCAACA[A/T]
TGTTTACCTCGATACTAAAAATAATAAGAATTATTATGATATTTCATAGTATTAAAGTTAACTAATGAGCAAATGGCAGGAACTATTGCCTCTCATGAAG

Reverse complement sequence

CTTCATGAGAGGCAATAGTTCCTGCCATTTGCTCATTAGTTAACTTTAATACTATGAAATATCATAATAATTCTTATTATTTTTAGTATCGAGGTAAACA[T/A]
TGTTGCACCAAATACAACAGGCTTAATAAGATATGATAAAAAAAAGAGTCGGGCACTAATGGGCTTTTATCAAAAAGAGAATAAATTATGCCCAATTTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.70%	30.40%	1.90%	4.06%	NA
All Indica	2759	47.30%	44.00%	2.39%	6.31%	NA
All Japonica	1512	87.80%	10.60%	0.60%	0.93%	NA
Aus	269	80.70%	13.40%	5.58%	0.37%	NA
Indica I	595	87.90%	8.90%	0.50%	2.69%	NA
Indica II	465	77.40%	17.60%	1.94%	3.01%	NA
Indica III	913	8.70%	79.80%	2.08%	9.42%	NA
Indica Intermediate	786	43.50%	44.70%	4.45%	7.38%	NA
Temperate Japonica	767	97.40%	2.30%	0.13%	0.13%	NA
Tropical Japonica	504	73.20%	23.80%	0.99%	1.98%	NA
Japonica Intermediate	241	88.00%	9.50%	1.24%	1.24%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	25.60%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125479021	A -> T	LOC_Os11g42300.1	upstream_gene_variant ; 3390.0bp to feature; MODIFIER	silent_mutation	Average:73.303; most accessible tissue: Callus, score: 91.947	N	N	N	N
vg1125479021	A -> T	LOC_Os11g42310.1	upstream_gene_variant ; 217.0bp to feature; MODIFIER	silent_mutation	Average:73.303; most accessible tissue: Callus, score: 91.947	N	N	N	N
vg1125479021	A -> T	LOC_Os11g42320.1	upstream_gene_variant ; 1117.0bp to feature; MODIFIER	silent_mutation	Average:73.303; most accessible tissue: Callus, score: 91.947	N	N	N	N
vg1125479021	A -> T	LOC_Os11g42310-LOC_Os11g42320	intergenic_region ; MODIFIER	silent_mutation	Average:73.303; most accessible tissue: Callus, score: 91.947	N	N	N	N
vg1125479021	A -> DEL	N	N	silent_mutation	Average:73.303; most accessible tissue: Callus, score: 91.947	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125479021	2.52E-08	1.39E-20	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	NA	5.13E-13	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	NA	4.40E-06	mr1242	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	1.41E-06	NA	mr1327	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	9.63E-07	9.63E-07	mr1540	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	7.06E-09	5.33E-12	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	5.61E-08	1.52E-10	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	NA	1.58E-07	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	NA	2.33E-06	mr1732	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	9.02E-07	8.06E-20	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	NA	1.08E-12	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	3.83E-09	8.83E-10	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	2.10E-07	1.46E-08	mr1662_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	NA	2.56E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021	NA	3.27E-08	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251