\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125479021:

Variant ID: vg1125479021 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25479021
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAATTGGGCATAATTTATTCTCTTTTTGATAAAAGCCCATTAGTGCCCGACTCTTTTTTTTATCATATCTTATTAAGCCTGTTGTATTTGGTGCAACA[A/T]
TGTTTACCTCGATACTAAAAATAATAAGAATTATTATGATATTTCATAGTATTAAAGTTAACTAATGAGCAAATGGCAGGAACTATTGCCTCTCATGAAG

Reverse complement sequence

CTTCATGAGAGGCAATAGTTCCTGCCATTTGCTCATTAGTTAACTTTAATACTATGAAATATCATAATAATTCTTATTATTTTTAGTATCGAGGTAAACA[T/A]
TGTTGCACCAAATACAACAGGCTTAATAAGATATGATAAAAAAAAGAGTCGGGCACTAATGGGCTTTTATCAAAAAGAGAATAAATTATGCCCAATTTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 30.40% 1.90% 4.06% NA
All Indica  2759 47.30% 44.00% 2.39% 6.31% NA
All Japonica  1512 87.80% 10.60% 0.60% 0.93% NA
Aus  269 80.70% 13.40% 5.58% 0.37% NA
Indica I  595 87.90% 8.90% 0.50% 2.69% NA
Indica II  465 77.40% 17.60% 1.94% 3.01% NA
Indica III  913 8.70% 79.80% 2.08% 9.42% NA
Indica Intermediate  786 43.50% 44.70% 4.45% 7.38% NA
Temperate Japonica  767 97.40% 2.30% 0.13% 0.13% NA
Tropical Japonica  504 73.20% 23.80% 0.99% 1.98% NA
Japonica Intermediate  241 88.00% 9.50% 1.24% 1.24% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 71.10% 25.60% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125479021 A -> T LOC_Os11g42300.1 upstream_gene_variant ; 3390.0bp to feature; MODIFIER silent_mutation Average:73.303; most accessible tissue: Callus, score: 91.947 N N N N
vg1125479021 A -> T LOC_Os11g42310.1 upstream_gene_variant ; 217.0bp to feature; MODIFIER silent_mutation Average:73.303; most accessible tissue: Callus, score: 91.947 N N N N
vg1125479021 A -> T LOC_Os11g42320.1 upstream_gene_variant ; 1117.0bp to feature; MODIFIER silent_mutation Average:73.303; most accessible tissue: Callus, score: 91.947 N N N N
vg1125479021 A -> T LOC_Os11g42310-LOC_Os11g42320 intergenic_region ; MODIFIER silent_mutation Average:73.303; most accessible tissue: Callus, score: 91.947 N N N N
vg1125479021 A -> DEL N N silent_mutation Average:73.303; most accessible tissue: Callus, score: 91.947 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125479021 2.52E-08 1.39E-20 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 NA 5.13E-13 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 NA 4.40E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 1.41E-06 NA mr1327 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 9.63E-07 9.63E-07 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 7.06E-09 5.33E-12 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 5.61E-08 1.52E-10 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 NA 1.58E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 NA 2.33E-06 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 9.02E-07 8.06E-20 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 NA 1.08E-12 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 3.83E-09 8.83E-10 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 2.10E-07 1.46E-08 mr1662_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 NA 2.56E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125479021 NA 3.27E-08 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251