\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125473544:

Variant ID: vg1125473544 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25473544
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTAGCTCGACCTCCTCTACCGGCCTTCGAAACGACGCGGCCGGTTCTGCTCCCTCCCGACCTGGCCACGCGGGGGGGCCAGATCCGCCTGCGTCAGAT[C/T]
CATCGCCTCCGGCCGCCAGCGGCACCGAAGACCCCCGCCTCCGTCCCTCCATCTGTTCCCCTTCAGAGCTCCATCTGTCAGGTAGAGGCGCGAGGGAGAA

Reverse complement sequence

TTCTCCCTCGCGCCTCTACCTGACAGATGGAGCTCTGAAGGGGAACAGATGGAGGGACGGAGGCGGGGGTCTTCGGTGCCGCTGGCGGCCGGAGGCGATG[G/A]
ATCTGACGCAGGCGGATCTGGCCCCCCCGCGTGGCCAGGTCGGGAGGGAGCAGAACCGGCCGCGTCGTTTCGAAGGCCGGTAGAGGAGGTCGAGCTACCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 15.40% 1.02% 0.06% NA
All Indica  2759 78.70% 20.80% 0.43% 0.04% NA
All Japonica  1512 91.10% 8.70% 0.07% 0.07% NA
Aus  269 90.70% 2.60% 6.69% 0.00% NA
Indica I  595 95.80% 4.20% 0.00% 0.00% NA
Indica II  465 95.50% 4.10% 0.43% 0.00% NA
Indica III  913 58.80% 40.70% 0.44% 0.00% NA
Indica Intermediate  786 79.00% 20.10% 0.76% 0.13% NA
Temperate Japonica  767 98.80% 1.00% 0.13% 0.00% NA
Tropical Japonica  504 80.20% 19.80% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.00% 0.00% 0.41% NA
VI/Aromatic  96 85.40% 0.00% 13.54% 1.04% NA
Intermediate  90 76.70% 18.90% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125473544 C -> T LOC_Os11g42300.1 downstream_gene_variant ; 606.0bp to feature; MODIFIER silent_mutation Average:74.495; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1125473544 C -> T LOC_Os11g42310.1 downstream_gene_variant ; 3485.0bp to feature; MODIFIER silent_mutation Average:74.495; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1125473544 C -> T LOC_Os11g42290-LOC_Os11g42300 intergenic_region ; MODIFIER silent_mutation Average:74.495; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1125473544 C -> DEL N N silent_mutation Average:74.495; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125473544 3.89E-14 6.93E-16 mr1662 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125473544 4.61E-09 7.06E-09 mr1662 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125473544 NA 5.41E-06 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125473544 1.35E-12 1.25E-15 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125473544 4.06E-07 2.76E-08 mr1662_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125473544 8.61E-06 2.27E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251