\
| Variant ID: vg1125473544 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25473544 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 99. )
CGGTAGCTCGACCTCCTCTACCGGCCTTCGAAACGACGCGGCCGGTTCTGCTCCCTCCCGACCTGGCCACGCGGGGGGGCCAGATCCGCCTGCGTCAGAT[C/T]
CATCGCCTCCGGCCGCCAGCGGCACCGAAGACCCCCGCCTCCGTCCCTCCATCTGTTCCCCTTCAGAGCTCCATCTGTCAGGTAGAGGCGCGAGGGAGAA
TTCTCCCTCGCGCCTCTACCTGACAGATGGAGCTCTGAAGGGGAACAGATGGAGGGACGGAGGCGGGGGTCTTCGGTGCCGCTGGCGGCCGGAGGCGATG[G/A]
ATCTGACGCAGGCGGATCTGGCCCCCCCGCGTGGCCAGGTCGGGAGGGAGCAGAACCGGCCGCGTCGTTTCGAAGGCCGGTAGAGGAGGTCGAGCTACCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 15.40% | 1.02% | 0.06% | NA |
| All Indica | 2759 | 78.70% | 20.80% | 0.43% | 0.04% | NA |
| All Japonica | 1512 | 91.10% | 8.70% | 0.07% | 0.07% | NA |
| Aus | 269 | 90.70% | 2.60% | 6.69% | 0.00% | NA |
| Indica I | 595 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 58.80% | 40.70% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 79.00% | 20.10% | 0.76% | 0.13% | NA |
| Temperate Japonica | 767 | 98.80% | 1.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 13.54% | 1.04% | NA |
| Intermediate | 90 | 76.70% | 18.90% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125473544 | C -> T | LOC_Os11g42300.1 | downstream_gene_variant ; 606.0bp to feature; MODIFIER | silent_mutation | Average:74.495; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1125473544 | C -> T | LOC_Os11g42310.1 | downstream_gene_variant ; 3485.0bp to feature; MODIFIER | silent_mutation | Average:74.495; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1125473544 | C -> T | LOC_Os11g42290-LOC_Os11g42300 | intergenic_region ; MODIFIER | silent_mutation | Average:74.495; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg1125473544 | C -> DEL | N | N | silent_mutation | Average:74.495; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125473544 | 3.89E-14 | 6.93E-16 | mr1662 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125473544 | 4.61E-09 | 7.06E-09 | mr1662 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125473544 | NA | 5.41E-06 | mr1662 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125473544 | 1.35E-12 | 1.25E-15 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125473544 | 4.06E-07 | 2.76E-08 | mr1662_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125473544 | 8.61E-06 | 2.27E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |