Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125473544:

Variant ID: vg1125473544 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25473544
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CGGTAGCTCGACCTCCTCTACCGGCCTTCGAAACGACGCGGCCGGTTCTGCTCCCTCCCGACCTGGCCACGCGGGGGGGCCAGATCCGCCTGCGTCAGAT[C/T]
CATCGCCTCCGGCCGCCAGCGGCACCGAAGACCCCCGCCTCCGTCCCTCCATCTGTTCCCCTTCAGAGCTCCATCTGTCAGGTAGAGGCGCGAGGGAGAA

Reverse complement sequence

TTCTCCCTCGCGCCTCTACCTGACAGATGGAGCTCTGAAGGGGAACAGATGGAGGGACGGAGGCGGGGGTCTTCGGTGCCGCTGGCGGCCGGAGGCGATG[G/A]
ATCTGACGCAGGCGGATCTGGCCCCCCCGCGTGGCCAGGTCGGGAGGGAGCAGAACCGGCCGCGTCGTTTCGAAGGCCGGTAGAGGAGGTCGAGCTACCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.50%	15.40%	1.02%	0.06%	NA
All Indica	2759	78.70%	20.80%	0.43%	0.04%	NA
All Japonica	1512	91.10%	8.70%	0.07%	0.07%	NA
Aus	269	90.70%	2.60%	6.69%	0.00%	NA
Indica I	595	95.80%	4.20%	0.00%	0.00%	NA
Indica II	465	95.50%	4.10%	0.43%	0.00%	NA
Indica III	913	58.80%	40.70%	0.44%	0.00%	NA
Indica Intermediate	786	79.00%	20.10%	0.76%	0.13%	NA
Temperate Japonica	767	98.80%	1.00%	0.13%	0.00%	NA
Tropical Japonica	504	80.20%	19.80%	0.00%	0.00%	NA
Japonica Intermediate	241	89.60%	10.00%	0.00%	0.41%	NA
VI/Aromatic	96	85.40%	0.00%	13.54%	1.04%	NA
Intermediate	90	76.70%	18.90%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125473544	C -> T	LOC_Os11g42300.1	downstream_gene_variant ; 606.0bp to feature; MODIFIER	silent_mutation	Average:74.495; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1125473544	C -> T	LOC_Os11g42310.1	downstream_gene_variant ; 3485.0bp to feature; MODIFIER	silent_mutation	Average:74.495; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1125473544	C -> T	LOC_Os11g42290-LOC_Os11g42300	intergenic_region ; MODIFIER	silent_mutation	Average:74.495; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N
vg1125473544	C -> DEL	N	N	silent_mutation	Average:74.495; most accessible tissue: Zhenshan97 panicle, score: 84.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125473544	3.89E-14	6.93E-16	mr1662	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125473544	4.61E-09	7.06E-09	mr1662	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125473544	NA	5.41E-06	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125473544	1.35E-12	1.25E-15	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125473544	4.06E-07	2.76E-08	mr1662_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125473544	8.61E-06	2.27E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251