| Variant ID: vg1125471041 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25471041 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACGCGCTAATAGACCGCTCTGTTTTCCGTGCGGGGAGTTTAGTTCCCAACTTCCCATATCTGAACACAGCCCAAACAAATCATCTTTCTCATATTATTTT[C/T]
ACAAAATTTCAAAATTCATTATTTCTATAATATTTAACGTATATTCATCTATTAATTTCGCAACAATTGCAGAGTGAACTTTTACAACCTACTACTCCGT
ACGGAGTAGTAGGTTGTAAAAGTTCACTCTGCAATTGTTGCGAAATTAATAGATGAATATACGTTAAATATTATAGAAATAATGAATTTTGAAATTTTGT[G/A]
AAAATAATATGAGAAAGATGATTTGTTTGGGCTGTGTTCAGATATGGGAAGTTGGGAACTAAACTCCCCGCACGGAAAACAGAGCGGTCTATTAGCGCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.50% | 15.70% | 0.63% | 1.23% | NA |
| All Indica | 2759 | 76.70% | 21.10% | 0.40% | 1.74% | NA |
| All Japonica | 1512 | 90.50% | 8.90% | 0.13% | 0.46% | NA |
| Aus | 269 | 90.70% | 2.60% | 5.95% | 0.74% | NA |
| Indica I | 595 | 95.50% | 4.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 89.50% | 4.30% | 0.86% | 5.38% | NA |
| Indica III | 913 | 59.00% | 40.90% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 75.60% | 20.90% | 0.76% | 2.80% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.60% | 20.00% | 0.20% | 1.19% | NA |
| Japonica Intermediate | 241 | 88.80% | 10.40% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 81.10% | 17.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125471041 | C -> T | LOC_Os11g42290.1 | upstream_gene_variant ; 2910.0bp to feature; MODIFIER | silent_mutation | Average:55.799; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg1125471041 | C -> T | LOC_Os11g42300.1 | downstream_gene_variant ; 3109.0bp to feature; MODIFIER | silent_mutation | Average:55.799; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg1125471041 | C -> T | LOC_Os11g42290-LOC_Os11g42300 | intergenic_region ; MODIFIER | silent_mutation | Average:55.799; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg1125471041 | C -> DEL | N | N | silent_mutation | Average:55.799; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125471041 | 1.24E-14 | 1.26E-16 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125471041 | 9.37E-10 | 1.09E-09 | mr1662 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125471041 | NA | 5.41E-06 | mr1662 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125471041 | 9.23E-13 | 5.15E-16 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125471041 | 2.00E-07 | 6.75E-09 | mr1662_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125471041 | 8.61E-06 | 2.27E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |