\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125470914:

Variant ID: vg1125470914 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 25470914
Reference Allele: TAlternative Allele: TA,G,A,TAA,TGA
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTTTTCACGCACACGCTTTTTAAACTATTAAATGGTGTGTGTTTTACAAAAAAAATTCTATATGAAAGTTATTTAAAAAATCATATTGATCCTTTTTT[T/TA,G,A,TAA,TGA]
AAAAAAAAGCAAATACTTAATTAATCACGCGCTAATAGACCGCTCTGTTTTCCGTGCGGGGAGTTTAGTTCCCAACTTCCCATATCTGAACACAGCCCAA

Reverse complement sequence

TTGGGCTGTGTTCAGATATGGGAAGTTGGGAACTAAACTCCCCGCACGGAAAACAGAGCGGTCTATTAGCGCGTGATTAATTAAGTATTTGCTTTTTTTT[A/TA,C,T,TTA,TCA]
AAAAAAGGATCAATATGATTTTTTAAATAACTTTCATATAGAATTTTTTTTGTAAAACACACACCATTTAATAGTTTAAAAAGCGTGTGCGTGAAAAATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.40% 36.40% 1.61% 0.04% TA: 13.33%; A: 1.06%; TAA: 0.13%; TGA: 0.06%
All Indica  2759 40.30% 53.50% 0.87% 0.04% TA: 4.97%; A: 0.25%; TAA: 0.04%; TGA: 0.04%
All Japonica  1512 54.00% 12.60% 1.12% 0.00% TA: 31.15%; A: 0.86%; TAA: 0.33%
Aus  269 64.30% 10.80% 10.78% 0.00% A: 10.41%; TA: 2.97%; TGA: 0.74%
Indica I  595 85.70% 13.10% 0.84% 0.00% A: 0.34%
Indica II  465 61.50% 22.40% 1.08% 0.00% TA: 15.05%
Indica III  913 7.30% 91.70% 0.22% 0.11% TA: 0.55%; A: 0.11%
Indica Intermediate  786 31.80% 58.00% 1.53% 0.00% TA: 7.89%; A: 0.51%; TGA: 0.13%; TAA: 0.13%
Temperate Japonica  767 84.50% 2.70% 0.26% 0.00% TA: 12.52%
Tropical Japonica  504 12.30% 27.60% 1.79% 0.00% TA: 56.75%; A: 0.99%; TAA: 0.60%
Japonica Intermediate  241 44.00% 12.40% 2.49% 0.00% TA: 36.93%; A: 3.32%; TAA: 0.83%
VI/Aromatic  96 89.60% 0.00% 2.08% 0.00% TA: 7.29%; A: 1.04%
Intermediate  90 55.60% 30.00% 4.44% 1.11% TA: 7.78%; A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125470914 T -> TA LOC_Os11g42290.1 upstream_gene_variant ; 2784.0bp to feature; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> TA LOC_Os11g42300.1 downstream_gene_variant ; 3235.0bp to feature; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> TA LOC_Os11g42290-LOC_Os11g42300 intergenic_region ; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> A LOC_Os11g42290.1 upstream_gene_variant ; 2783.0bp to feature; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> A LOC_Os11g42300.1 downstream_gene_variant ; 3236.0bp to feature; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> A LOC_Os11g42290-LOC_Os11g42300 intergenic_region ; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> TGA LOC_Os11g42290.1 upstream_gene_variant ; 2784.0bp to feature; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> TGA LOC_Os11g42300.1 downstream_gene_variant ; 3235.0bp to feature; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> TGA LOC_Os11g42290-LOC_Os11g42300 intergenic_region ; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> DEL N N silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> TAA LOC_Os11g42290.1 upstream_gene_variant ; 2784.0bp to feature; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> TAA LOC_Os11g42300.1 downstream_gene_variant ; 3235.0bp to feature; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> TAA LOC_Os11g42290-LOC_Os11g42300 intergenic_region ; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> G LOC_Os11g42290.1 upstream_gene_variant ; 2783.0bp to feature; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> G LOC_Os11g42300.1 downstream_gene_variant ; 3236.0bp to feature; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N
vg1125470914 T -> G LOC_Os11g42290-LOC_Os11g42300 intergenic_region ; MODIFIER silent_mutation Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125470914 NA 1.89E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125470914 NA 2.19E-09 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 2.45E-19 3.64E-38 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 1.52E-18 6.15E-33 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 NA 7.66E-07 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 2.77E-07 4.01E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 4.33E-08 4.33E-08 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 8.72E-16 2.44E-19 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 2.56E-09 2.18E-13 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 NA 2.60E-06 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 3.53E-12 3.59E-20 mr1667 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 4.37E-12 1.52E-18 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 1.42E-06 6.24E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 2.13E-07 5.96E-08 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 NA 6.59E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 NA 4.43E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 1.09E-18 2.03E-37 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 3.04E-16 6.38E-31 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 1.27E-13 1.51E-15 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 1.23E-07 2.92E-11 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 1.97E-06 1.17E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 5.72E-12 2.87E-21 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470914 8.61E-13 1.82E-20 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251