\
| Variant ID: vg1125470914 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 25470914 |
| Reference Allele: T | Alternative Allele: TA,G,A,TAA,TGA |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CATTTTTCACGCACACGCTTTTTAAACTATTAAATGGTGTGTGTTTTACAAAAAAAATTCTATATGAAAGTTATTTAAAAAATCATATTGATCCTTTTTT[T/TA,G,A,TAA,TGA]
AAAAAAAAGCAAATACTTAATTAATCACGCGCTAATAGACCGCTCTGTTTTCCGTGCGGGGAGTTTAGTTCCCAACTTCCCATATCTGAACACAGCCCAA
TTGGGCTGTGTTCAGATATGGGAAGTTGGGAACTAAACTCCCCGCACGGAAAACAGAGCGGTCTATTAGCGCGTGATTAATTAAGTATTTGCTTTTTTTT[A/TA,C,T,TTA,TCA]
AAAAAAGGATCAATATGATTTTTTAAATAACTTTCATATAGAATTTTTTTTGTAAAACACACACCATTTAATAGTTTAAAAAGCGTGTGCGTGAAAAATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.40% | 36.40% | 1.61% | 0.04% | TA: 13.33%; A: 1.06%; TAA: 0.13%; TGA: 0.06% |
| All Indica | 2759 | 40.30% | 53.50% | 0.87% | 0.04% | TA: 4.97%; A: 0.25%; TAA: 0.04%; TGA: 0.04% |
| All Japonica | 1512 | 54.00% | 12.60% | 1.12% | 0.00% | TA: 31.15%; A: 0.86%; TAA: 0.33% |
| Aus | 269 | 64.30% | 10.80% | 10.78% | 0.00% | A: 10.41%; TA: 2.97%; TGA: 0.74% |
| Indica I | 595 | 85.70% | 13.10% | 0.84% | 0.00% | A: 0.34% |
| Indica II | 465 | 61.50% | 22.40% | 1.08% | 0.00% | TA: 15.05% |
| Indica III | 913 | 7.30% | 91.70% | 0.22% | 0.11% | TA: 0.55%; A: 0.11% |
| Indica Intermediate | 786 | 31.80% | 58.00% | 1.53% | 0.00% | TA: 7.89%; A: 0.51%; TGA: 0.13%; TAA: 0.13% |
| Temperate Japonica | 767 | 84.50% | 2.70% | 0.26% | 0.00% | TA: 12.52% |
| Tropical Japonica | 504 | 12.30% | 27.60% | 1.79% | 0.00% | TA: 56.75%; A: 0.99%; TAA: 0.60% |
| Japonica Intermediate | 241 | 44.00% | 12.40% | 2.49% | 0.00% | TA: 36.93%; A: 3.32%; TAA: 0.83% |
| VI/Aromatic | 96 | 89.60% | 0.00% | 2.08% | 0.00% | TA: 7.29%; A: 1.04% |
| Intermediate | 90 | 55.60% | 30.00% | 4.44% | 1.11% | TA: 7.78%; A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125470914 | T -> TA | LOC_Os11g42290.1 | upstream_gene_variant ; 2784.0bp to feature; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> TA | LOC_Os11g42300.1 | downstream_gene_variant ; 3235.0bp to feature; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> TA | LOC_Os11g42290-LOC_Os11g42300 | intergenic_region ; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> A | LOC_Os11g42290.1 | upstream_gene_variant ; 2783.0bp to feature; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> A | LOC_Os11g42300.1 | downstream_gene_variant ; 3236.0bp to feature; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> A | LOC_Os11g42290-LOC_Os11g42300 | intergenic_region ; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> TGA | LOC_Os11g42290.1 | upstream_gene_variant ; 2784.0bp to feature; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> TGA | LOC_Os11g42300.1 | downstream_gene_variant ; 3235.0bp to feature; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> TGA | LOC_Os11g42290-LOC_Os11g42300 | intergenic_region ; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> DEL | N | N | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> TAA | LOC_Os11g42290.1 | upstream_gene_variant ; 2784.0bp to feature; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> TAA | LOC_Os11g42300.1 | downstream_gene_variant ; 3235.0bp to feature; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> TAA | LOC_Os11g42290-LOC_Os11g42300 | intergenic_region ; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> G | LOC_Os11g42290.1 | upstream_gene_variant ; 2783.0bp to feature; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> G | LOC_Os11g42300.1 | downstream_gene_variant ; 3236.0bp to feature; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| vg1125470914 | T -> G | LOC_Os11g42290-LOC_Os11g42300 | intergenic_region ; MODIFIER | silent_mutation | Average:41.31; most accessible tissue: Minghui63 root, score: 65.279 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125470914 | NA | 1.89E-09 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1125470914 | NA | 2.19E-09 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 2.45E-19 | 3.64E-38 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 1.52E-18 | 6.15E-33 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | NA | 7.66E-07 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 2.77E-07 | 4.01E-13 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 4.33E-08 | 4.33E-08 | mr1540 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 8.72E-16 | 2.44E-19 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 2.56E-09 | 2.18E-13 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | NA | 2.60E-06 | mr1662 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 3.53E-12 | 3.59E-20 | mr1667 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 4.37E-12 | 1.52E-18 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 1.42E-06 | 6.24E-13 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 2.13E-07 | 5.96E-08 | mr1732 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | NA | 6.59E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | NA | 4.43E-07 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 1.09E-18 | 2.03E-37 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 3.04E-16 | 6.38E-31 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 1.27E-13 | 1.51E-15 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 1.23E-07 | 2.92E-11 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 1.97E-06 | 1.17E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 5.72E-12 | 2.87E-21 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125470914 | 8.61E-13 | 1.82E-20 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |