\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125470848:

Variant ID: vg1125470848 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25470848
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATGTTGTAGAGTTGAACATATAAGTATATGTGTTTGCAATTCCATGTTCTCACCTCATCTCCCTCATTTTTCACGCACACGCTTTTTAAACTATTAAA[T/C]
GGTGTGTGTTTTACAAAAAAAATTCTATATGAAAGTTATTTAAAAAATCATATTGATCCTTTTTTTAAAAAAAAGCAAATACTTAATTAATCACGCGCTA

Reverse complement sequence

TAGCGCGTGATTAATTAAGTATTTGCTTTTTTTTAAAAAAAGGATCAATATGATTTTTTAAATAACTTTCATATAGAATTTTTTTTGTAAAACACACACC[A/G]
TTTAATAGTTTAAAAAGCGTGTGCGTGAAAAATGAGGGAGATGAGGTGAGAACATGGAATTGCAAACACATATACTTATATGTTCAACTCTACAACATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 37.20% 0.59% 0.23% NA
All Indica  2759 45.60% 53.80% 0.25% 0.40% NA
All Japonica  1512 87.20% 12.60% 0.13% 0.00% NA
Aus  269 74.30% 20.10% 5.58% 0.00% NA
Indica I  595 86.10% 13.80% 0.17% 0.00% NA
Indica II  465 76.60% 22.60% 0.43% 0.43% NA
Indica III  913 7.70% 91.60% 0.11% 0.66% NA
Indica Intermediate  786 40.60% 58.70% 0.38% 0.38% NA
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 71.80% 27.80% 0.40% 0.00% NA
Japonica Intermediate  241 87.60% 12.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 65.60% 30.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125470848 T -> DEL N N silent_mutation Average:42.983; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg1125470848 T -> C LOC_Os11g42290.1 upstream_gene_variant ; 2717.0bp to feature; MODIFIER silent_mutation Average:42.983; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg1125470848 T -> C LOC_Os11g42300.1 downstream_gene_variant ; 3302.0bp to feature; MODIFIER silent_mutation Average:42.983; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg1125470848 T -> C LOC_Os11g42290-LOC_Os11g42300 intergenic_region ; MODIFIER silent_mutation Average:42.983; most accessible tissue: Minghui63 root, score: 67.149 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125470848 NA 5.07E-09 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 7.02E-18 4.18E-37 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 4.27E-17 4.93E-31 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 NA 3.69E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 8.05E-08 2.39E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 1.56E-08 1.56E-08 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 1.58E-12 2.26E-16 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 1.04E-07 4.92E-12 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 NA 2.60E-06 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 6.07E-11 2.21E-19 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 1.86E-10 7.84E-17 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 7.59E-08 7.20E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 2.03E-08 9.92E-09 mr1732 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 NA 9.73E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 NA 2.60E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 NA 1.24E-06 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 3.71E-16 6.70E-34 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 2.02E-14 2.60E-29 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 NA 1.70E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 3.60E-12 9.68E-15 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 9.77E-07 3.46E-10 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 1.97E-06 1.17E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 7.63E-11 9.42E-20 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848 1.31E-11 3.86E-19 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251