Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125470848:

Variant ID: vg1125470848 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25470848
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAATGTTGTAGAGTTGAACATATAAGTATATGTGTTTGCAATTCCATGTTCTCACCTCATCTCCCTCATTTTTCACGCACACGCTTTTTAAACTATTAAA[T/C]
GGTGTGTGTTTTACAAAAAAAATTCTATATGAAAGTTATTTAAAAAATCATATTGATCCTTTTTTTAAAAAAAAGCAAATACTTAATTAATCACGCGCTA

Reverse complement sequence

TAGCGCGTGATTAATTAAGTATTTGCTTTTTTTTAAAAAAAGGATCAATATGATTTTTTAAATAACTTTCATATAGAATTTTTTTTGTAAAACACACACC[A/G]
TTTAATAGTTTAAAAAGCGTGTGCGTGAAAAATGAGGGAGATGAGGTGAGAACATGGAATTGCAAACACATATACTTATATGTTCAACTCTACAACATTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.00%	37.20%	0.59%	0.23%	NA
All Indica	2759	45.60%	53.80%	0.25%	0.40%	NA
All Japonica	1512	87.20%	12.60%	0.13%	0.00%	NA
Aus	269	74.30%	20.10%	5.58%	0.00%	NA
Indica I	595	86.10%	13.80%	0.17%	0.00%	NA
Indica II	465	76.60%	22.60%	0.43%	0.43%	NA
Indica III	913	7.70%	91.60%	0.11%	0.66%	NA
Indica Intermediate	786	40.60%	58.70%	0.38%	0.38%	NA
Temperate Japonica	767	97.30%	2.70%	0.00%	0.00%	NA
Tropical Japonica	504	71.80%	27.80%	0.40%	0.00%	NA
Japonica Intermediate	241	87.60%	12.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	65.60%	30.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125470848	T -> DEL	N	N	silent_mutation	Average:42.983; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg1125470848	T -> C	LOC_Os11g42290.1	upstream_gene_variant ; 2717.0bp to feature; MODIFIER	silent_mutation	Average:42.983; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg1125470848	T -> C	LOC_Os11g42300.1	downstream_gene_variant ; 3302.0bp to feature; MODIFIER	silent_mutation	Average:42.983; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N
vg1125470848	T -> C	LOC_Os11g42290-LOC_Os11g42300	intergenic_region ; MODIFIER	silent_mutation	Average:42.983; most accessible tissue: Minghui63 root, score: 67.149	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125470848	NA	5.07E-09	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	7.02E-18	4.18E-37	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	4.27E-17	4.93E-31	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	NA	3.69E-06	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	8.05E-08	2.39E-12	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	1.56E-08	1.56E-08	mr1540	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	1.58E-12	2.26E-16	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	1.04E-07	4.92E-12	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	NA	2.60E-06	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	6.07E-11	2.21E-19	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	1.86E-10	7.84E-17	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	7.59E-08	7.20E-13	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	2.03E-08	9.92E-09	mr1732	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	NA	9.73E-06	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	NA	2.60E-06	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	NA	1.24E-06	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	3.71E-16	6.70E-34	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	2.02E-14	2.60E-29	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	NA	1.70E-06	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	3.60E-12	9.68E-15	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	9.77E-07	3.46E-10	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	1.97E-06	1.17E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	7.63E-11	9.42E-20	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125470848	1.31E-11	3.86E-19	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251