\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125468181:

Variant ID: vg1125468181 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25468181
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, G: 0.09, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTCCATTAGTGAACTGTACGTTCTCTTGATCTTTTGCTTGTTGGTGCTCTTCGAGAGGCACCAATGGCATCACATATATAGAGAGCGGAGGTAGGTAG[C/G]
TAGCTAGCTAGCTTCGAGAGATGATAAGAATTAATCGATTCCCATTTTTAAAAGTGTTAAATTATCGAATCTCTCGTAGAAGGCTAGGGGCTTGGAAAAC

Reverse complement sequence

GTTTTCCAAGCCCCTAGCCTTCTACGAGAGATTCGATAATTTAACACTTTTAAAAATGGGAATCGATTAATTCTTATCATCTCTCGAAGCTAGCTAGCTA[G/C]
CTACCTACCTCCGCTCTCTATATATGTGATGCCATTGGTGCCTCTCGAAGAGCACCAACAAGCAAAAGATCAAGAGAACGTACAGTTCACTAATGGAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 45.80% 0.25% 0.02% NA
All Indica  2759 31.90% 67.70% 0.36% 0.00% NA
All Japonica  1512 86.60% 13.20% 0.13% 0.07% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 46.10% 53.60% 0.34% 0.00% NA
Indica II  465 57.40% 42.40% 0.22% 0.00% NA
Indica III  913 8.10% 91.70% 0.22% 0.00% NA
Indica Intermediate  786 33.70% 65.60% 0.64% 0.00% NA
Temperate Japonica  767 96.00% 4.00% 0.00% 0.00% NA
Tropical Japonica  504 72.00% 27.60% 0.20% 0.20% NA
Japonica Intermediate  241 87.60% 12.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125468181 C -> DEL N N silent_mutation Average:72.423; most accessible tissue: Minghui63 root, score: 88.035 N N N N
vg1125468181 C -> G LOC_Os11g42280.1 upstream_gene_variant ; 2515.0bp to feature; MODIFIER silent_mutation Average:72.423; most accessible tissue: Minghui63 root, score: 88.035 N N N N
vg1125468181 C -> G LOC_Os11g42290.1 upstream_gene_variant ; 50.0bp to feature; MODIFIER silent_mutation Average:72.423; most accessible tissue: Minghui63 root, score: 88.035 N N N N
vg1125468181 C -> G LOC_Os11g42290-LOC_Os11g42300 intergenic_region ; MODIFIER silent_mutation Average:72.423; most accessible tissue: Minghui63 root, score: 88.035 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125468181 C G 0.04 0.01 0.0 0.01 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125468181 6.46E-11 5.50E-24 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 5.43E-09 3.75E-14 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 4.42E-09 3.47E-17 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 1.36E-11 1.28E-15 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 3.09E-07 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 NA 7.91E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 NA 2.24E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 2.80E-16 9.03E-24 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 3.41E-17 7.31E-23 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 3.31E-07 6.23E-14 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 1.13E-06 2.57E-09 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 2.58E-06 5.81E-11 mr1945 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 2.67E-06 2.67E-06 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 2.01E-09 1.44E-21 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 2.20E-06 5.55E-11 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 1.05E-10 2.69E-26 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 1.28E-13 9.78E-22 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 4.06E-07 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 NA 1.26E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 NA 4.09E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 2.57E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 NA 1.36E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 1.19E-06 7.93E-14 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 NA 1.22E-07 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 3.28E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 NA 8.19E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125468181 NA 5.83E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251