\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125464486:

Variant ID: vg1125464486 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25464486
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GTAACTCAATCCAGGGAGGAATCCATCGTCGTCATCGCAATGATCTCGCAAGAAATGATCGATAAACGAGTCAAAAACCAACCTGAGAATTTCTTCGAAA[G/A]
AAATGCTGCACTCGTTTGGAGTTCTTGGAGGTGCCGACGAGATTCAGCTTGAGCTCGCGAAGCACCGGGCAGCAATGGAGGATGCTCGCGACCGCCGCCG

Reverse complement sequence

CGGCGGCGGTCGCGAGCATCCTCCATTGCTGCCCGGTGCTTCGCGAGCTCAAGCTGAATCTCGTCGGCACCTCCAAGAACTCCAAACGAGTGCAGCATTT[C/T]
TTTCGAAGAAATTCTCAGGTTGGTTTTTGACTCGTTTATCGATCATTTCTTGCGAGATCATTGCGATGACGACGATGGATTCCTCCCTGGATTGAGTTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 37.20% 0.17% 0.25% NA
All Indica  2759 45.70% 53.80% 0.22% 0.33% NA
All Japonica  1512 87.20% 12.50% 0.07% 0.20% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 86.40% 13.10% 0.00% 0.50% NA
Indica II  465 76.60% 23.00% 0.22% 0.22% NA
Indica III  913 7.90% 91.80% 0.22% 0.11% NA
Indica Intermediate  786 40.50% 58.70% 0.38% 0.51% NA
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 71.80% 27.40% 0.20% 0.60% NA
Japonica Intermediate  241 87.60% 12.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 66.70% 32.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125464486 G -> A LOC_Os11g42280.1 synonymous_variant ; p.Phe370Phe; LOW synonymous_codon Average:56.398; most accessible tissue: Callus, score: 79.967 N N N N
vg1125464486 G -> DEL LOC_Os11g42280.1 N frameshift_variant Average:56.398; most accessible tissue: Callus, score: 79.967 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125464486 NA 2.49E-09 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 1.31E-17 5.10E-38 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 5.07E-17 1.09E-31 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 NA 1.71E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 6.67E-06 NA mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 1.41E-07 1.41E-07 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 1.24E-15 1.12E-18 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 5.30E-09 5.18E-13 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 NA 2.60E-06 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 4.23E-10 1.59E-18 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 7.19E-11 3.04E-17 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 9.66E-07 2.30E-07 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 NA 8.93E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 NA 5.21E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 2.21E-19 1.92E-38 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 1.24E-17 1.21E-32 mr1133_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 2.74E-13 2.11E-15 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 4.09E-07 1.20E-10 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 1.97E-06 1.17E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 6.91E-13 1.06E-22 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 2.79E-13 4.45E-21 mr1667_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125464486 NA 4.19E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251