\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125463766:

Variant ID: vg1125463766 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25463766
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.03, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CAAACATGCAATCCATACGTATCTTGATCATTCACCTTTCACACGTTGTGTGAGGCACACACAAATCCAGATGTACTCAATACCCTACAAAAATATTACC[T/G]
GGCTCCGACAACGACGACTAGCCTTGGATGATTAATTTGTGCTAGAAAAAAAAGATACGAATATTAGGAAGGACCTAATATCAAATAATTAGAAGGGGTG

Reverse complement sequence

CACCCCTTCTAATTATTTGATATTAGGTCCTTCCTAATATTCGTATCTTTTTTTTCTAGCACAAATTAATCATCCAAGGCTAGTCGTCGTTGTCGGAGCC[A/C]
GGTAATATTTTTGTAGGGTATTGAGTACATCTGGATTTGTGTGTGCCTCACACAACGTGTGAAAGGTGAATGATCAAGATACGTATGGATTGCATGTTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 5.10% 1.33% 30.66% NA
All Indica  2759 46.20% 7.50% 1.09% 45.13% NA
All Japonica  1512 87.60% 1.60% 0.40% 10.38% NA
Aus  269 80.30% 1.50% 8.92% 9.29% NA
Indica I  595 86.90% 1.00% 0.67% 11.43% NA
Indica II  465 76.80% 2.80% 1.29% 19.14% NA
Indica III  913 8.20% 14.50% 0.99% 76.34% NA
Indica Intermediate  786 41.60% 7.30% 1.40% 49.75% NA
Temperate Japonica  767 97.30% 0.30% 0.13% 2.35% NA
Tropical Japonica  504 73.00% 3.60% 0.60% 22.82% NA
Japonica Intermediate  241 87.60% 1.70% 0.83% 9.96% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 65.60% 6.70% 3.33% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125463766 T -> DEL N N silent_mutation Average:39.031; most accessible tissue: Callus, score: 77.264 N N N N
vg1125463766 T -> G LOC_Os11g42270.1 upstream_gene_variant ; 768.0bp to feature; MODIFIER silent_mutation Average:39.031; most accessible tissue: Callus, score: 77.264 N N N N
vg1125463766 T -> G LOC_Os11g42280.1 downstream_gene_variant ; 690.0bp to feature; MODIFIER silent_mutation Average:39.031; most accessible tissue: Callus, score: 77.264 N N N N
vg1125463766 T -> G LOC_Os11g42290.1 downstream_gene_variant ; 2791.0bp to feature; MODIFIER silent_mutation Average:39.031; most accessible tissue: Callus, score: 77.264 N N N N
vg1125463766 T -> G LOC_Os11g42270-LOC_Os11g42280 intergenic_region ; MODIFIER silent_mutation Average:39.031; most accessible tissue: Callus, score: 77.264 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125463766 NA 9.67E-10 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 1.19E-17 1.82E-37 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 4.16E-18 2.65E-32 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 NA 9.29E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 1.60E-06 NA mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 4.45E-08 4.45E-08 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 4.02E-15 1.60E-18 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 1.43E-08 7.49E-13 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 NA 5.66E-06 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 2.76E-10 2.42E-18 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 4.25E-11 3.17E-17 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 5.58E-06 NA mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 1.57E-07 4.64E-08 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 NA 2.95E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 NA 6.42E-06 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 NA 5.08E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 1.34E-18 1.13E-37 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 3.22E-16 4.50E-31 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 1.39E-11 3.40E-14 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 7.34E-07 1.50E-10 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 3.01E-13 4.74E-23 mr1667_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125463766 7.28E-13 1.31E-20 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251