\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125443769:

Variant ID: vg1125443769 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25443769
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.19, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


ACTACTCGAACAAGAAAGATGGCAAAAGATTCCATGGGGACCACTCTCAACCACTCCTCCCAGCTGGTACCAAAAGACCATAATGACCTCCAAAATATAC[C/T]
AAAATGTGGTGACTTCGTCAATCTCTCCAGGATTTGCCGGCCTAGTCTTCAAAGATGCTCATAGGGGTAGGGTTTGCGTACGTGCGTTCATAGGGGTGAG

Reverse complement sequence

CTCACCCCTATGAACGCACGTACGCAAACCCTACCCCTATGAGCATCTTTGAAGACTAGGCCGGCAAATCCTGGAGAGATTGACGAAGTCACCACATTTT[G/A]
GTATATTTTGGAGGTCATTATGGTCTTTTGGTACCAGCTGGGAGGAGTGGTTGAGAGTGGTCCCCATGGAATCTTTTGCCATCTTTCTTGTTCGAGTAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 43.20% 0.08% 0.00% NA
All Indica  2759 45.10% 54.90% 0.04% 0.00% NA
All Japonica  1512 72.10% 27.80% 0.13% 0.00% NA
Aus  269 71.70% 28.30% 0.00% 0.00% NA
Indica I  595 85.20% 14.60% 0.17% 0.00% NA
Indica II  465 77.20% 22.80% 0.00% 0.00% NA
Indica III  913 7.60% 92.40% 0.00% 0.00% NA
Indica Intermediate  786 39.20% 60.80% 0.00% 0.00% NA
Temperate Japonica  767 85.70% 14.30% 0.00% 0.00% NA
Tropical Japonica  504 60.30% 39.50% 0.20% 0.00% NA
Japonica Intermediate  241 53.50% 46.10% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125443769 C -> T LOC_Os11g42240.1 upstream_gene_variant ; 937.0bp to feature; MODIFIER silent_mutation Average:72.154; most accessible tissue: Minghui63 young leaf, score: 92.827 N N N N
vg1125443769 C -> T LOC_Os11g42240-LOC_Os11g42250 intergenic_region ; MODIFIER silent_mutation Average:72.154; most accessible tissue: Minghui63 young leaf, score: 92.827 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125443769 C T 0.08 0.0 0.0 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125443769 NA 2.63E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125443769 NA 9.90E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125443769 NA 1.50E-08 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 5.64E-11 2.77E-22 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 6.46E-18 1.56E-31 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 3.09E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 NA 1.33E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 9.20E-08 9.21E-08 mr1540 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 3.01E-14 1.81E-20 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 1.48E-08 9.71E-13 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 1.37E-07 4.23E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 9.16E-12 4.93E-18 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 4.38E-07 9.40E-08 mr1732 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 NA 5.22E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 NA 3.72E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 NA 2.19E-07 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 9.82E-12 5.79E-21 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 9.30E-16 2.54E-29 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 7.37E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 6.04E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 4.23E-11 9.13E-19 mr1662_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 3.71E-07 6.61E-11 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 2.48E-08 2.92E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 3.40E-12 2.55E-19 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125443769 4.82E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251