Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125440253:

Variant ID: vg1125440253 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25440253
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

CGATACTGTTCGACTTAGGCCTACAACTCCATTTGTGGACTGAGCCAAAGAGAGGTAGACCGAGCAGAGGGAGATAGAGGACTGTACTAGGACTAGAGCT[G/A]
AAAAGGACGGAAGGAATGTGCGTTCATTTGGTCCAAAACGCACGGGCATTAAAGGGAGTATAGTGCGTAGGATAAAAAAATATTTTTACCCGTTGCAACG

Reverse complement sequence

CGTTGCAACGGGTAAAAATATTTTTTTATCCTACGCACTATACTCCCTTTAATGCCCGTGCGTTTTGGACCAAATGAACGCACATTCCTTCCGTCCTTTT[C/T]
AGCTCTAGTCCTAGTACAGTCCTCTATCTCCCTCTGCTCGGTCTACCTCTCTTTGGCTCAGTCCACAAATGGAGTTGTAGGCCTAAGTCGAACAGTATCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.70%	7.80%	0.38%	3.11%	NA
All Indica	2759	86.60%	8.10%	0.54%	4.75%	NA
All Japonica	1512	90.80%	8.50%	0.13%	0.53%	NA
Aus	269	97.40%	2.20%	0.37%	0.00%	NA
Indica I	595	95.10%	3.40%	0.67%	0.84%	NA
Indica II	465	97.80%	1.70%	0.00%	0.43%	NA
Indica III	913	75.70%	14.30%	0.44%	9.53%	NA
Indica Intermediate	786	86.10%	8.30%	0.89%	4.71%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	79.20%	19.60%	0.20%	0.99%	NA
Japonica Intermediate	241	88.40%	10.00%	0.41%	1.24%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	8.90%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125440253	G -> A	LOC_Os11g42230.1	upstream_gene_variant ; 3246.0bp to feature; MODIFIER	silent_mutation	Average:47.813; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N
vg1125440253	G -> A	LOC_Os11g42240.1	downstream_gene_variant ; 621.0bp to feature; MODIFIER	silent_mutation	Average:47.813; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N
vg1125440253	G -> A	LOC_Os11g42230-LOC_Os11g42240	intergenic_region ; MODIFIER	silent_mutation	Average:47.813; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N
vg1125440253	G -> DEL	N	N	silent_mutation	Average:47.813; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125440253	NA	2.51E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125440253	3.77E-06	3.10E-10	mr1583	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125440253	1.06E-06	6.57E-11	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251