\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125426100:

Variant ID: vg1125426100 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25426100
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


AAATCCATTTGGATTTAATTTATGAAGAAGAGAACAATTATTTATGAAGAAAGTCACCTGTCAATTCTGGGGTACTTCAGAGGTCAGAGTTAACTCTGAA[C/T]
TTTCAGACTTCAGAGTTTAAGGCCATGTTTAGATTCCAACTTTTTTTTTTCAAACTTCCGACTTTTCTGTCACATCGAACTTTCCTACACATATAAACTT

Reverse complement sequence

AAGTTTATATGTGTAGGAAAGTTCGATGTGACAGAAAAGTCGGAAGTTTGAAAAAAAAAAGTTGGAATCTAAACATGGCCTTAAACTCTGAAGTCTGAAA[G/A]
TTCAGAGTTAACTCTGACCTCTGAAGTACCCCAGAATTGACAGGTGACTTTCTTCATAAATAATTGTTCTCTTCTTCATAAATTAAATCCAAATGGATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 48.70% 0.06% 0.00% NA
All Indica  2759 25.70% 74.20% 0.07% 0.00% NA
All Japonica  1512 86.40% 13.60% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 12.90% 86.70% 0.34% 0.00% NA
Indica II  465 55.30% 44.70% 0.00% 0.00% NA
Indica III  913 15.90% 84.10% 0.00% 0.00% NA
Indica Intermediate  786 29.40% 70.60% 0.00% 0.00% NA
Temperate Japonica  767 96.50% 3.50% 0.00% 0.00% NA
Tropical Japonica  504 71.00% 29.00% 0.00% 0.00% NA
Japonica Intermediate  241 86.70% 13.30% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125426100 C -> T LOC_Os11g42200.1 3_prime_UTR_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:42.05; most accessible tissue: Zhenshan97 flower, score: 54.272 N N N N
vg1125426100 C -> T LOC_Os11g42210.1 downstream_gene_variant ; 296.0bp to feature; MODIFIER silent_mutation Average:42.05; most accessible tissue: Zhenshan97 flower, score: 54.272 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125426100 2.25E-09 9.51E-20 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 8.57E-07 3.08E-09 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 NA 2.40E-06 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 1.73E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 5.24E-08 9.54E-12 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 2.96E-07 8.98E-10 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 2.24E-07 1.20E-13 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 7.70E-07 5.06E-08 mr1667 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 NA 3.26E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 1.77E-06 3.18E-17 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 NA 1.20E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 NA 1.37E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 NA 6.39E-09 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 4.80E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 NA 2.10E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 2.51E-07 3.00E-07 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 NA 4.27E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 3.48E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 NA 1.00E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 NA 8.40E-08 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125426100 NA 1.30E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251