Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125421780:

Variant ID: vg1125421780 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25421780
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, T: 0.11, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CATTTCCTTATCTCCCGTGTGATAATTTTTATCATTTGTTTAGTGCTGGTCAATTGCTAGTGCCTGGTCTTTGCATCCGTCTGCCACTCTGTTGAATAGT[G/T]
CCATGCAATGCATGTTTTTTTTCCCAAAACCAAACCATACAACTTTCAGTTATAAAGGGAAACCAGAATGGTAGACCATGCAATTCATTTATTTTTCTGA

Reverse complement sequence

TCAGAAAAATAAATGAATTGCATGGTCTACCATTCTGGTTTCCCTTTATAACTGAAAGTTGTATGGTTTGGTTTTGGGAAAAAAAACATGCATTGCATGG[C/A]
ACTATTCAACAGAGTGGCAGACGGATGCAAAGACCAGGCACTAGCAATTGACCAGCACTAAACAAATGATAAAAATTATCACACGGGAGATAAGGAAATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.50%	13.50%	0.00%	0.00%	NA
All Indica	2759	93.50%	6.50%	0.00%	0.00%	NA
All Japonica	1512	78.40%	21.60%	0.00%	0.00%	NA
Aus	269	71.70%	28.30%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	84.10%	15.90%	0.00%	0.00%	NA
Indica III	913	96.90%	3.10%	0.00%	0.00%	NA
Indica Intermediate	786	91.20%	8.80%	0.00%	0.00%	NA
Temperate Japonica	767	95.60%	4.40%	0.00%	0.00%	NA
Tropical Japonica	504	49.40%	50.60%	0.00%	0.00%	NA
Japonica Intermediate	241	84.60%	15.40%	0.00%	0.00%	NA
VI/Aromatic	96	52.10%	47.90%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125421780	G -> T	LOC_Os11g42200.1	upstream_gene_variant ; 1921.0bp to feature; MODIFIER	silent_mutation	Average:44.962; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N
vg1125421780	G -> T	LOC_Os11g42210.1	downstream_gene_variant ; 4616.0bp to feature; MODIFIER	silent_mutation	Average:44.962; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N
vg1125421780	G -> T	LOC_Os11g42190-LOC_Os11g42200	intergenic_region ; MODIFIER	silent_mutation	Average:44.962; most accessible tissue: Zhenshan97 root, score: 79.452	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125421780	4.65E-08	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	2.26E-13	1.98E-14	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	8.15E-10	1.17E-10	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	NA	9.70E-06	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	1.18E-06	NA	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	NA	3.84E-06	mr1484	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	1.35E-13	1.88E-13	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	9.30E-07	1.72E-08	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	NA	2.78E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	1.21E-07	3.58E-08	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	1.77E-08	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	3.04E-11	2.09E-12	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	3.41E-08	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	6.46E-11	2.56E-12	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	1.10E-16	1.12E-17	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	2.12E-06	NA	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	2.85E-07	1.33E-09	mr1662_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	1.94E-08	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	1.65E-13	4.65E-14	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	2.48E-07	2.31E-08	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	7.90E-06	2.59E-07	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	7.33E-07	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125421780	1.50E-08	1.50E-08	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251