Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125420730:

Variant ID: vg1125420730 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25420730
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.04, A: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TTATTAAAAAAATTAAGTAATTATTAATTATTTTTCTATCATTTGATTCATTGTTAAATATACTTATATGTATACATATATTTTTACATATTTCACAAAA[G/T]
TTTTTGAATAAAATGAACGGTCAAACGTGTGTTAAAAGTTAACGGTGTCAAATATTAGAAACGGAAGGAGTATATATTCAGCGATGTGACCTATTGATCT

Reverse complement sequence

AGATCAATAGGTCACATCGCTGAATATATACTCCTTCCGTTTCTAATATTTGACACCGTTAACTTTTAACACACGTTTGACCGTTCATTTTATTCAAAAA[C/A]
TTTTGTGAAATATGTAAAAATATATGTATACATATAAGTATATTTAACAATGAATCAAATGATAGAAAAATAATTAATAATTACTTAATTTTTTTAATAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	13.40%	0.00%	0.00%	NA
All Indica	2759	93.50%	6.50%	0.00%	0.00%	NA
All Japonica	1512	78.40%	21.60%	0.00%	0.00%	NA
Aus	269	71.70%	28.30%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	84.30%	15.70%	0.00%	0.00%	NA
Indica III	913	96.90%	3.10%	0.00%	0.00%	NA
Indica Intermediate	786	91.30%	8.70%	0.00%	0.00%	NA
Temperate Japonica	767	95.60%	4.40%	0.00%	0.00%	NA
Tropical Japonica	504	49.40%	50.60%	0.00%	0.00%	NA
Japonica Intermediate	241	84.60%	15.40%	0.00%	0.00%	NA
VI/Aromatic	96	53.10%	46.90%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125420730	G -> T	LOC_Os11g42190.1	upstream_gene_variant ; 4396.0bp to feature; MODIFIER	silent_mutation	Average:30.88; most accessible tissue: Callus, score: 65.001	N	N	N	N
vg1125420730	G -> T	LOC_Os11g42200.1	upstream_gene_variant ; 2971.0bp to feature; MODIFIER	silent_mutation	Average:30.88; most accessible tissue: Callus, score: 65.001	N	N	N	N
vg1125420730	G -> T	LOC_Os11g42190-LOC_Os11g42200	intergenic_region ; MODIFIER	silent_mutation	Average:30.88; most accessible tissue: Callus, score: 65.001	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125420730	3.25E-07	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	5.09E-10	2.38E-11	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	1.97E-08	2.37E-09	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	2.19E-06	NA	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	2.48E-12	5.36E-13	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	4.59E-07	8.01E-09	mr1662	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	8.09E-06	1.26E-06	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	1.97E-07	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	1.63E-08	3.61E-10	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	1.83E-07	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	5.65E-09	8.89E-11	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	1.68E-15	5.23E-17	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	2.74E-06	NA	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	7.33E-07	4.52E-09	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	3.66E-07	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	2.16E-09	3.95E-11	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	4.34E-06	1.75E-07	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	NA	1.89E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125420730	2.55E-07	2.55E-07	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251