\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125419021:

Variant ID: vg1125419021 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25419021
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


ACGAACCAAACTCATACTAAGAGTCCTAAATACCTTAGGAAACCCTCTAGTACAAGACACAAACTTTACATAACCAATCGTATCAAATTTGGACTCCTTC[C/T]
AAATTCGACTCCGCATCCCATACGCACACAATACCTCCATCGTATGCCATATGGAATCTTCACCAACCACGTGCATCAACTCTAGCCTTAGTATCCCGCA

Reverse complement sequence

TGCGGGATACTAAGGCTAGAGTTGATGCACGTGGTTGGTGAAGATTCCATATGGCATACGATGGAGGTATTGTGTGCGTATGGGATGCGGAGTCGAATTT[G/A]
GAAGGAGTCCAAATTTGATACGATTGGTTATGTAAAGTTTGTGTCTTGTACTAGAGGGTTTCCTAAGGTATTTAGGACTCTTAGTATGAGTTTGGTTCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.20% 13.80% 0.06% 0.00% NA
All Indica  2759 93.50% 6.50% 0.00% 0.00% NA
All Japonica  1512 78.40% 21.50% 0.13% 0.00% NA
Aus  269 66.90% 33.10% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 84.10% 15.90% 0.00% 0.00% NA
Indica III  913 96.90% 3.10% 0.00% 0.00% NA
Indica Intermediate  786 91.20% 8.80% 0.00% 0.00% NA
Temperate Japonica  767 95.60% 4.40% 0.00% 0.00% NA
Tropical Japonica  504 49.40% 50.40% 0.20% 0.00% NA
Japonica Intermediate  241 84.20% 15.40% 0.41% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125419021 C -> T LOC_Os11g42190.1 upstream_gene_variant ; 2687.0bp to feature; MODIFIER silent_mutation Average:41.754; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg1125419021 C -> T LOC_Os11g42200.1 upstream_gene_variant ; 4680.0bp to feature; MODIFIER silent_mutation Average:41.754; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg1125419021 C -> T LOC_Os11g42190-LOC_Os11g42200 intergenic_region ; MODIFIER silent_mutation Average:41.754; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125419021 1.29E-08 2.58E-10 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021 5.54E-07 2.56E-08 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021 8.93E-10 9.98E-12 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021 4.92E-06 NA mr1662 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021 NA 9.25E-06 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021 4.82E-11 1.33E-12 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021 4.34E-11 1.04E-12 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021 1.16E-10 1.10E-14 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021 2.39E-07 NA mr1662_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021 3.41E-12 3.64E-14 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021 1.43E-06 4.60E-08 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021 2.30E-08 2.30E-08 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251