\
| Variant ID: vg1125419021 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25419021 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 295. )
ACGAACCAAACTCATACTAAGAGTCCTAAATACCTTAGGAAACCCTCTAGTACAAGACACAAACTTTACATAACCAATCGTATCAAATTTGGACTCCTTC[C/T]
AAATTCGACTCCGCATCCCATACGCACACAATACCTCCATCGTATGCCATATGGAATCTTCACCAACCACGTGCATCAACTCTAGCCTTAGTATCCCGCA
TGCGGGATACTAAGGCTAGAGTTGATGCACGTGGTTGGTGAAGATTCCATATGGCATACGATGGAGGTATTGTGTGCGTATGGGATGCGGAGTCGAATTT[G/A]
GAAGGAGTCCAAATTTGATACGATTGGTTATGTAAAGTTTGTGTCTTGTACTAGAGGGTTTCCTAAGGTATTTAGGACTCTTAGTATGAGTTTGGTTCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.20% | 13.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 78.40% | 21.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 66.90% | 33.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 49.40% | 50.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 15.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 52.10% | 47.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125419021 | C -> T | LOC_Os11g42190.1 | upstream_gene_variant ; 2687.0bp to feature; MODIFIER | silent_mutation | Average:41.754; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg1125419021 | C -> T | LOC_Os11g42200.1 | upstream_gene_variant ; 4680.0bp to feature; MODIFIER | silent_mutation | Average:41.754; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg1125419021 | C -> T | LOC_Os11g42190-LOC_Os11g42200 | intergenic_region ; MODIFIER | silent_mutation | Average:41.754; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125419021 | 1.29E-08 | 2.58E-10 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125419021 | 5.54E-07 | 2.56E-08 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125419021 | 8.93E-10 | 9.98E-12 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125419021 | 4.92E-06 | NA | mr1662 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125419021 | NA | 9.25E-06 | mr1662 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125419021 | 4.82E-11 | 1.33E-12 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125419021 | 4.34E-11 | 1.04E-12 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125419021 | 1.16E-10 | 1.10E-14 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125419021 | 2.39E-07 | NA | mr1662_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125419021 | 3.41E-12 | 3.64E-14 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125419021 | 1.43E-06 | 4.60E-08 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125419021 | 2.30E-08 | 2.30E-08 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |