Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125419021:

Variant ID: vg1125419021 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25419021
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

ACGAACCAAACTCATACTAAGAGTCCTAAATACCTTAGGAAACCCTCTAGTACAAGACACAAACTTTACATAACCAATCGTATCAAATTTGGACTCCTTC[C/T]
AAATTCGACTCCGCATCCCATACGCACACAATACCTCCATCGTATGCCATATGGAATCTTCACCAACCACGTGCATCAACTCTAGCCTTAGTATCCCGCA

Reverse complement sequence

TGCGGGATACTAAGGCTAGAGTTGATGCACGTGGTTGGTGAAGATTCCATATGGCATACGATGGAGGTATTGTGTGCGTATGGGATGCGGAGTCGAATTT[G/A]
GAAGGAGTCCAAATTTGATACGATTGGTTATGTAAAGTTTGTGTCTTGTACTAGAGGGTTTCCTAAGGTATTTAGGACTCTTAGTATGAGTTTGGTTCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.20%	13.80%	0.06%	0.00%	NA
All Indica	2759	93.50%	6.50%	0.00%	0.00%	NA
All Japonica	1512	78.40%	21.50%	0.13%	0.00%	NA
Aus	269	66.90%	33.10%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	84.10%	15.90%	0.00%	0.00%	NA
Indica III	913	96.90%	3.10%	0.00%	0.00%	NA
Indica Intermediate	786	91.20%	8.80%	0.00%	0.00%	NA
Temperate Japonica	767	95.60%	4.40%	0.00%	0.00%	NA
Tropical Japonica	504	49.40%	50.40%	0.20%	0.00%	NA
Japonica Intermediate	241	84.20%	15.40%	0.41%	0.00%	NA
VI/Aromatic	96	52.10%	47.90%	0.00%	0.00%	NA
Intermediate	90	87.80%	11.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125419021	C -> T	LOC_Os11g42190.1	upstream_gene_variant ; 2687.0bp to feature; MODIFIER	silent_mutation	Average:41.754; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg1125419021	C -> T	LOC_Os11g42200.1	upstream_gene_variant ; 4680.0bp to feature; MODIFIER	silent_mutation	Average:41.754; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg1125419021	C -> T	LOC_Os11g42190-LOC_Os11g42200	intergenic_region ; MODIFIER	silent_mutation	Average:41.754; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125419021	1.29E-08	2.58E-10	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021	5.54E-07	2.56E-08	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021	8.93E-10	9.98E-12	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021	4.92E-06	NA	mr1662	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021	NA	9.25E-06	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021	4.82E-11	1.33E-12	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021	4.34E-11	1.04E-12	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021	1.16E-10	1.10E-14	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021	2.39E-07	NA	mr1662_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021	3.41E-12	3.64E-14	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021	1.43E-06	4.60E-08	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125419021	2.30E-08	2.30E-08	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251