\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125403382:

Variant ID: vg1125403382 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 25403382
Reference Allele: GAlternative Allele: C,GCA,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAATGAAACAGATTCCCCTTAATTATAGAACGTTTCTGTTATATCCGGGTAACCGTTGCAACGGGGCACACTGTGGTGGAGACACGTGGTGAGCGC[G/C,GCA,A]
GGTGCGCGTGGTGGCGGCATGTTGGCGGCGGACGCGCGGGTGCCCGACTTATATTGGCGCGCATCGGGCACCCGACGCAAAGGATTTTCCATATTTCAGT

Reverse complement sequence

ACTGAAATATGGAAAATCCTTTGCGTCGGGTGCCCGATGCGCGCCAATATAAGTCGGGCACCCGCGCGTCCGCCGCCAACATGCCGCCACCACGCGCACC[C/G,TGC,T]
GCGCTCACCACGTGTCTCCACCACAGTGTGCCCCGTTGCAACGGTTACCCGGATATAACAGAAACGTTCTATAATTAAGGGGAATCTGTTTCATTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 6.30% 0.08% 0.00% GCA: 6.14%; A: 0.02%
All Indica  2759 99.70% 0.10% 0.00% 0.00% GCA: 0.18%
All Japonica  1512 63.20% 18.10% 0.13% 0.00% GCA: 18.58%
Aus  269 94.80% 4.50% 0.37% 0.00% A: 0.37%
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.70% 0.00% 0.00% 0.00% GCA: 0.33%
Indica Intermediate  786 99.60% 0.10% 0.00% 0.00% GCA: 0.25%
Temperate Japonica  767 68.20% 28.90% 0.00% 0.00% GCA: 2.87%
Tropical Japonica  504 50.40% 2.60% 0.40% 0.00% GCA: 46.63%
Japonica Intermediate  241 74.30% 15.80% 0.00% 0.00% GCA: 9.96%
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 8.90% 1.11% 0.00% GCA: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125403382 G -> GCA LOC_Os11g42160.1 downstream_gene_variant ; 4079.0bp to feature; MODIFIER silent_mutation Average:60.945; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1125403382 G -> GCA LOC_Os11g42170.1 downstream_gene_variant ; 2706.0bp to feature; MODIFIER silent_mutation Average:60.945; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1125403382 G -> GCA LOC_Os11g42180.1 downstream_gene_variant ; 2705.0bp to feature; MODIFIER silent_mutation Average:60.945; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1125403382 G -> GCA LOC_Os11g42170-LOC_Os11g42180 intergenic_region ; MODIFIER silent_mutation Average:60.945; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1125403382 G -> A LOC_Os11g42160.1 downstream_gene_variant ; 4078.0bp to feature; MODIFIER silent_mutation Average:60.945; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1125403382 G -> A LOC_Os11g42170.1 downstream_gene_variant ; 2705.0bp to feature; MODIFIER silent_mutation Average:60.945; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1125403382 G -> A LOC_Os11g42180.1 downstream_gene_variant ; 2706.0bp to feature; MODIFIER silent_mutation Average:60.945; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1125403382 G -> A LOC_Os11g42170-LOC_Os11g42180 intergenic_region ; MODIFIER silent_mutation Average:60.945; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1125403382 G -> C LOC_Os11g42160.1 downstream_gene_variant ; 4078.0bp to feature; MODIFIER silent_mutation Average:60.945; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1125403382 G -> C LOC_Os11g42170.1 downstream_gene_variant ; 2705.0bp to feature; MODIFIER silent_mutation Average:60.945; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1125403382 G -> C LOC_Os11g42180.1 downstream_gene_variant ; 2706.0bp to feature; MODIFIER silent_mutation Average:60.945; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N
vg1125403382 G -> C LOC_Os11g42170-LOC_Os11g42180 intergenic_region ; MODIFIER silent_mutation Average:60.945; most accessible tissue: Zhenshan97 root, score: 88.995 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125403382 G A 0.1 0.05 0.03 0.03 0.07 0.08
vg1125403382 G C -0.02 -0.02 -0.02 -0.05 -0.05 -0.03
vg1125403382 G GCA -0.57 -0.28 -0.22 -0.24 -0.4 -0.36

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125403382 6.19E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 3.10E-09 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 5.15E-07 NA mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 2.21E-10 1.91E-12 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 1.03E-06 1.86E-09 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 2.65E-11 NA mr1745 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 2.00E-06 NA mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 8.04E-07 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 NA 1.43E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 4.11E-07 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 1.37E-11 NA mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 1.15E-08 6.53E-14 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 2.02E-07 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125403382 7.75E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251