\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125393643:

Variant ID: vg1125393643 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25393643
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, G: 0.14, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGTTTAGATCTAGTGGTGAAAAGTTTCGGCGTGTCACATCGGATATACGGACACATATTTAAAGTATTAAACGTAGATTAATAACAAAACAAATTACA[T/G]
ATTCCGCTTGTAAACTGCAAGACGAATTTATTAAGTCTAAAGAATCCGTCATTAGCAAATGTTTACTGTAGCACCACATTATCAAATCATGTAGCAATTA

Reverse complement sequence

TAATTGCTACATGATTTGATAATGTGGTGCTACAGTAAACATTTGCTAATGACGGATTCTTTAGACTTAATAAATTCGTCTTGCAGTTTACAAGCGGAAT[A/C]
TGTAATTTGTTTTGTTATTAATCTACGTTTAATACTTTAAATATGTGTCCGTATATCCGATGTGACACGCCGAAACTTTTCACCACTAGATCTAAACACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 41.10% 0.47% 0.00% NA
All Indica  2759 67.50% 31.90% 0.62% 0.00% NA
All Japonica  1512 43.30% 56.70% 0.07% 0.00% NA
Aus  269 58.00% 41.30% 0.74% 0.00% NA
Indica I  595 77.30% 21.30% 1.34% 0.00% NA
Indica II  465 53.10% 45.80% 1.08% 0.00% NA
Indica III  913 71.00% 29.00% 0.00% 0.00% NA
Indica Intermediate  786 64.40% 35.10% 0.51% 0.00% NA
Temperate Japonica  767 35.60% 64.40% 0.00% 0.00% NA
Tropical Japonica  504 59.70% 40.30% 0.00% 0.00% NA
Japonica Intermediate  241 33.20% 66.40% 0.41% 0.00% NA
VI/Aromatic  96 47.90% 52.10% 0.00% 0.00% NA
Intermediate  90 50.00% 47.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125393643 T -> G LOC_Os11g42160.1 upstream_gene_variant ; 528.0bp to feature; MODIFIER silent_mutation Average:45.882; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1125393643 T -> G LOC_Os11g42150-LOC_Os11g42160 intergenic_region ; MODIFIER silent_mutation Average:45.882; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125393643 1.33E-09 NA mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393643 5.40E-08 3.47E-07 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393643 NA 9.10E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393643 NA 8.82E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251