Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125393643:

Variant ID: vg1125393643 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25393643
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, G: 0.14, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

CGTGTTTAGATCTAGTGGTGAAAAGTTTCGGCGTGTCACATCGGATATACGGACACATATTTAAAGTATTAAACGTAGATTAATAACAAAACAAATTACA[T/G]
ATTCCGCTTGTAAACTGCAAGACGAATTTATTAAGTCTAAAGAATCCGTCATTAGCAAATGTTTACTGTAGCACCACATTATCAAATCATGTAGCAATTA

Reverse complement sequence

TAATTGCTACATGATTTGATAATGTGGTGCTACAGTAAACATTTGCTAATGACGGATTCTTTAGACTTAATAAATTCGTCTTGCAGTTTACAAGCGGAAT[A/C]
TGTAATTTGTTTTGTTATTAATCTACGTTTAATACTTTAAATATGTGTCCGTATATCCGATGTGACACGCCGAAACTTTTCACCACTAGATCTAAACACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	41.10%	0.47%	0.00%	NA
All Indica	2759	67.50%	31.90%	0.62%	0.00%	NA
All Japonica	1512	43.30%	56.70%	0.07%	0.00%	NA
Aus	269	58.00%	41.30%	0.74%	0.00%	NA
Indica I	595	77.30%	21.30%	1.34%	0.00%	NA
Indica II	465	53.10%	45.80%	1.08%	0.00%	NA
Indica III	913	71.00%	29.00%	0.00%	0.00%	NA
Indica Intermediate	786	64.40%	35.10%	0.51%	0.00%	NA
Temperate Japonica	767	35.60%	64.40%	0.00%	0.00%	NA
Tropical Japonica	504	59.70%	40.30%	0.00%	0.00%	NA
Japonica Intermediate	241	33.20%	66.40%	0.41%	0.00%	NA
VI/Aromatic	96	47.90%	52.10%	0.00%	0.00%	NA
Intermediate	90	50.00%	47.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125393643	T -> G	LOC_Os11g42160.1	upstream_gene_variant ; 528.0bp to feature; MODIFIER	silent_mutation	Average:45.882; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1125393643	T -> G	LOC_Os11g42150-LOC_Os11g42160	intergenic_region ; MODIFIER	silent_mutation	Average:45.882; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125393643	1.33E-09	NA	mr1484	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393643	5.40E-08	3.47E-07	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393643	NA	9.10E-06	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125393643	NA	8.82E-06	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251