\
| Variant ID: vg1125392771 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25392771 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACCTGATTGAGATAGATTTATCCGTGACGGCCGTTTGCCCGATTGAGATAACTCTTCACATCTGTGACTTCTAGCCTGTGACGGACGCCGTGCCCGATTA[A/G]
GATGGGGTTTACCGTCCAATTGAGATGATGGTATCCCTTCTAGTGTTAGTTTGAAGCACTCCTGAATCCTGAACTTAAAGCGCTTATCCCGTCTCAAATC
GATTTGAGACGGGATAAGCGCTTTAAGTTCAGGATTCAGGAGTGCTTCAAACTAACACTAGAAGGGATACCATCATCTCAATTGGACGGTAAACCCCATC[T/C]
TAATCGGGCACGGCGTCCGTCACAGGCTAGAAGTCACAGATGTGAAGAGTTATCTCAATCGGGCAAACGGCCGTCACGGATAAATCTATCTCAATCAGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 36.60% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 45.70% | 54.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 86.60% | 13.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 59.00% | 40.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 77.00% | 23.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 24.40% | 75.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 41.90% | 58.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 69.80% | 29.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125392771 | A -> G | LOC_Os11g42160.1 | upstream_gene_variant ; 1400.0bp to feature; MODIFIER | silent_mutation | Average:53.509; most accessible tissue: Zhenshan97 root, score: 71.174 | N | N | N | N |
| vg1125392771 | A -> G | LOC_Os11g42150-LOC_Os11g42160 | intergenic_region ; MODIFIER | silent_mutation | Average:53.509; most accessible tissue: Zhenshan97 root, score: 71.174 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125392771 | NA | 1.43E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125392771 | 1.16E-08 | 1.28E-09 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125392771 | 1.72E-06 | 3.75E-07 | mr1662 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125392771 | NA | 4.02E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125392771 | 2.70E-06 | 2.80E-06 | mr1794 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125392771 | NA | 2.35E-06 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125392771 | NA | 3.97E-06 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125392771 | 5.00E-08 | 1.06E-08 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125392771 | NA | 3.32E-06 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |