\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125392771:

Variant ID: vg1125392771 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25392771
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTGATTGAGATAGATTTATCCGTGACGGCCGTTTGCCCGATTGAGATAACTCTTCACATCTGTGACTTCTAGCCTGTGACGGACGCCGTGCCCGATTA[A/G]
GATGGGGTTTACCGTCCAATTGAGATGATGGTATCCCTTCTAGTGTTAGTTTGAAGCACTCCTGAATCCTGAACTTAAAGCGCTTATCCCGTCTCAAATC

Reverse complement sequence

GATTTGAGACGGGATAAGCGCTTTAAGTTCAGGATTCAGGAGTGCTTCAAACTAACACTAGAAGGGATACCATCATCTCAATTGGACGGTAAACCCCATC[T/C]
TAATCGGGCACGGCGTCCGTCACAGGCTAGAAGTCACAGATGTGAAGAGTTATCTCAATCGGGCAAACGGCCGTCACGGATAAATCTATCTCAATCAGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 36.60% 0.08% 0.00% NA
All Indica  2759 45.70% 54.20% 0.07% 0.00% NA
All Japonica  1512 86.60% 13.30% 0.13% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 59.00% 40.80% 0.17% 0.00% NA
Indica II  465 77.00% 23.00% 0.00% 0.00% NA
Indica III  913 24.40% 75.60% 0.00% 0.00% NA
Indica Intermediate  786 41.90% 58.00% 0.13% 0.00% NA
Temperate Japonica  767 97.50% 2.50% 0.00% 0.00% NA
Tropical Japonica  504 69.80% 29.80% 0.40% 0.00% NA
Japonica Intermediate  241 86.70% 13.30% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125392771 A -> G LOC_Os11g42160.1 upstream_gene_variant ; 1400.0bp to feature; MODIFIER silent_mutation Average:53.509; most accessible tissue: Zhenshan97 root, score: 71.174 N N N N
vg1125392771 A -> G LOC_Os11g42150-LOC_Os11g42160 intergenic_region ; MODIFIER silent_mutation Average:53.509; most accessible tissue: Zhenshan97 root, score: 71.174 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125392771 NA 1.43E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771 1.16E-08 1.28E-09 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771 1.72E-06 3.75E-07 mr1662 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771 NA 4.02E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771 2.70E-06 2.80E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771 NA 2.35E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771 NA 3.97E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771 5.00E-08 1.06E-08 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771 NA 3.32E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251