Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125392771:

Variant ID: vg1125392771 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25392771
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTGATTGAGATAGATTTATCCGTGACGGCCGTTTGCCCGATTGAGATAACTCTTCACATCTGTGACTTCTAGCCTGTGACGGACGCCGTGCCCGATTA[A/G]
GATGGGGTTTACCGTCCAATTGAGATGATGGTATCCCTTCTAGTGTTAGTTTGAAGCACTCCTGAATCCTGAACTTAAAGCGCTTATCCCGTCTCAAATC

Reverse complement sequence

GATTTGAGACGGGATAAGCGCTTTAAGTTCAGGATTCAGGAGTGCTTCAAACTAACACTAGAAGGGATACCATCATCTCAATTGGACGGTAAACCCCATC[T/C]
TAATCGGGCACGGCGTCCGTCACAGGCTAGAAGTCACAGATGTGAAGAGTTATCTCAATCGGGCAAACGGCCGTCACGGATAAATCTATCTCAATCAGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.30%	36.60%	0.08%	0.00%	NA
All Indica	2759	45.70%	54.20%	0.07%	0.00%	NA
All Japonica	1512	86.60%	13.30%	0.13%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	59.00%	40.80%	0.17%	0.00%	NA
Indica II	465	77.00%	23.00%	0.00%	0.00%	NA
Indica III	913	24.40%	75.60%	0.00%	0.00%	NA
Indica Intermediate	786	41.90%	58.00%	0.13%	0.00%	NA
Temperate Japonica	767	97.50%	2.50%	0.00%	0.00%	NA
Tropical Japonica	504	69.80%	29.80%	0.40%	0.00%	NA
Japonica Intermediate	241	86.70%	13.30%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	67.80%	32.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125392771	A -> G	LOC_Os11g42160.1	upstream_gene_variant ; 1400.0bp to feature; MODIFIER	silent_mutation	Average:53.509; most accessible tissue: Zhenshan97 root, score: 71.174	N	N	N	N
vg1125392771	A -> G	LOC_Os11g42150-LOC_Os11g42160	intergenic_region ; MODIFIER	silent_mutation	Average:53.509; most accessible tissue: Zhenshan97 root, score: 71.174	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125392771	NA	1.43E-06	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771	1.16E-08	1.28E-09	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771	1.72E-06	3.75E-07	mr1662	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771	NA	4.02E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771	2.70E-06	2.80E-06	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771	NA	2.35E-06	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771	NA	3.97E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771	5.00E-08	1.06E-08	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392771	NA	3.32E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251