\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125392589:

Variant ID: vg1125392589 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25392589
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TGACGGGCATTAACTTAGGCCCGATTGAGATGATGGTCATCTGTGACGGGTAATGCCCGTTACAGATAAGGGTCATCTGTGACGGGCGCTAGTTGTGGCC[T/C]
GATTGAGATAGGTCATCTGTGACGGGCTATAATTTGACTGGTCGTCTGGGTCAAAGCTATCGGTGACGGGCTTTAATTAGGACCTGATTGAGATAGATTT

Reverse complement sequence

AAATCTATCTCAATCAGGTCCTAATTAAAGCCCGTCACCGATAGCTTTGACCCAGACGACCAGTCAAATTATAGCCCGTCACAGATGACCTATCTCAATC[A/G]
GGCCACAACTAGCGCCCGTCACAGATGACCCTTATCTGTAACGGGCATTACCCGTCACAGATGACCATCATCTCAATCGGGCCTAAGTTAATGCCCGTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.50% 34.20% 0.32% 0.00% NA
All Indica  2759 77.60% 22.30% 0.11% 0.00% NA
All Japonica  1512 46.60% 53.20% 0.20% 0.00% NA
Aus  269 54.30% 43.50% 2.23% 0.00% NA
Indica I  595 52.30% 47.70% 0.00% 0.00% NA
Indica II  465 63.90% 36.10% 0.00% 0.00% NA
Indica III  913 96.70% 3.20% 0.11% 0.00% NA
Indica Intermediate  786 82.70% 17.00% 0.25% 0.00% NA
Temperate Japonica  767 54.10% 45.90% 0.00% 0.00% NA
Tropical Japonica  504 39.30% 60.30% 0.40% 0.00% NA
Japonica Intermediate  241 37.80% 61.80% 0.41% 0.00% NA
VI/Aromatic  96 53.10% 45.80% 1.04% 0.00% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125392589 T -> C LOC_Os11g42160.1 upstream_gene_variant ; 1582.0bp to feature; MODIFIER silent_mutation Average:28.692; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg1125392589 T -> C LOC_Os11g42150-LOC_Os11g42160 intergenic_region ; MODIFIER silent_mutation Average:28.692; most accessible tissue: Minghui63 root, score: 49.234 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125392589 NA 2.23E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 5.64E-07 NA mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 2.97E-07 3.79E-09 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 3.40E-06 NA mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 NA 7.68E-07 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 1.59E-06 9.39E-10 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 6.35E-06 1.97E-08 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 2.48E-11 3.99E-14 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 2.48E-14 1.39E-18 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 6.59E-11 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 NA 2.16E-08 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 4.37E-06 1.05E-06 mr1745 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 NA 5.54E-08 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 3.09E-07 5.30E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 2.09E-09 6.42E-15 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 9.61E-10 NA mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 NA 1.23E-09 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 1.29E-10 2.73E-16 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 7.39E-14 4.68E-21 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 5.27E-08 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589 NA 1.22E-09 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251