Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125392589:

Variant ID: vg1125392589 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25392589
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TGACGGGCATTAACTTAGGCCCGATTGAGATGATGGTCATCTGTGACGGGTAATGCCCGTTACAGATAAGGGTCATCTGTGACGGGCGCTAGTTGTGGCC[T/C]
GATTGAGATAGGTCATCTGTGACGGGCTATAATTTGACTGGTCGTCTGGGTCAAAGCTATCGGTGACGGGCTTTAATTAGGACCTGATTGAGATAGATTT

Reverse complement sequence

AAATCTATCTCAATCAGGTCCTAATTAAAGCCCGTCACCGATAGCTTTGACCCAGACGACCAGTCAAATTATAGCCCGTCACAGATGACCTATCTCAATC[A/G]
GGCCACAACTAGCGCCCGTCACAGATGACCCTTATCTGTAACGGGCATTACCCGTCACAGATGACCATCATCTCAATCGGGCCTAAGTTAATGCCCGTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.50%	34.20%	0.32%	0.00%	NA
All Indica	2759	77.60%	22.30%	0.11%	0.00%	NA
All Japonica	1512	46.60%	53.20%	0.20%	0.00%	NA
Aus	269	54.30%	43.50%	2.23%	0.00%	NA
Indica I	595	52.30%	47.70%	0.00%	0.00%	NA
Indica II	465	63.90%	36.10%	0.00%	0.00%	NA
Indica III	913	96.70%	3.20%	0.11%	0.00%	NA
Indica Intermediate	786	82.70%	17.00%	0.25%	0.00%	NA
Temperate Japonica	767	54.10%	45.90%	0.00%	0.00%	NA
Tropical Japonica	504	39.30%	60.30%	0.40%	0.00%	NA
Japonica Intermediate	241	37.80%	61.80%	0.41%	0.00%	NA
VI/Aromatic	96	53.10%	45.80%	1.04%	0.00%	NA
Intermediate	90	58.90%	38.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125392589	T -> C	LOC_Os11g42160.1	upstream_gene_variant ; 1582.0bp to feature; MODIFIER	silent_mutation	Average:28.692; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N
vg1125392589	T -> C	LOC_Os11g42150-LOC_Os11g42160	intergenic_region ; MODIFIER	silent_mutation	Average:28.692; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125392589	NA	2.23E-07	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	5.64E-07	NA	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	2.97E-07	3.79E-09	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	3.40E-06	NA	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	NA	7.68E-07	mr1530	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	1.59E-06	9.39E-10	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	6.35E-06	1.97E-08	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	2.48E-11	3.99E-14	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	2.48E-14	1.39E-18	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	6.59E-11	NA	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	NA	2.16E-08	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	4.37E-06	1.05E-06	mr1745	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	NA	5.54E-08	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	3.09E-07	5.30E-13	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	2.09E-09	6.42E-15	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	9.61E-10	NA	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	NA	1.23E-09	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	1.29E-10	2.73E-16	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	7.39E-14	4.68E-21	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	5.27E-08	NA	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125392589	NA	1.22E-09	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251