\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125391579:

Variant ID: vg1125391579 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25391579
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, C: 0.35, T: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TTACGGGTAGTAAATGATTTCAAATGGAAAAAATGTCAACAACAAAGTTGTATAACTTATCAAGATTTACAACTTTTAGTTTCGTCATTTTTCTATATAA[A/C]
ATTTTTTTTGAACACTTTGAATTTGAATTTGAAAATATAACAAATTCAACAACATTTTCAAATACTAAACGATTTCAATTGAAAAAGTCATCAACAACAA

Reverse complement sequence

TTGTTGTTGATGACTTTTTCAATTGAAATCGTTTAGTATTTGAAAATGTTGTTGAATTTGTTATATTTTCAAATTCAAATTCAAAGTGTTCAAAAAAAAT[T/G]
TTATATAGAAAAATGACGAAACTAAAAGTTGTAAATCTTGATAAGTTATACAACTTTGTTGTTGACATTTTTTCCATTTGAAATCATTTACTACCCGTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.00% 33.10% 15.89% 4.06% NA
All Indica  2759 43.90% 24.20% 25.23% 6.67% NA
All Japonica  1512 49.30% 47.30% 2.84% 0.53% NA
Aus  269 61.70% 38.30% 0.00% 0.00% NA
Indica I  595 53.40% 14.50% 28.91% 3.19% NA
Indica II  465 40.90% 40.90% 15.48% 2.80% NA
Indica III  913 44.60% 20.90% 26.40% 8.11% NA
Indica Intermediate  786 37.80% 25.40% 26.84% 9.92% NA
Temperate Japonica  767 34.90% 63.40% 1.04% 0.65% NA
Tropical Japonica  504 74.20% 18.80% 6.35% 0.60% NA
Japonica Intermediate  241 43.20% 55.60% 1.24% 0.00% NA
VI/Aromatic  96 45.80% 53.10% 1.04% 0.00% NA
Intermediate  90 58.90% 28.90% 12.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125391579 A -> DEL N N silent_mutation Average:13.249; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N
vg1125391579 A -> C LOC_Os11g42160.1 upstream_gene_variant ; 2592.0bp to feature; MODIFIER silent_mutation Average:13.249; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N
vg1125391579 A -> C LOC_Os11g42150-LOC_Os11g42160 intergenic_region ; MODIFIER silent_mutation Average:13.249; most accessible tissue: Zhenshan97 root, score: 22.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125391579 8.68E-07 3.01E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 4.21E-08 1.04E-10 mr1191 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 NA 7.24E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 1.27E-06 NA mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 3.28E-06 NA mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 2.63E-07 1.25E-12 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 2.11E-07 2.40E-10 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 NA 1.58E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 NA 2.95E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 5.67E-06 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 NA 2.33E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 1.62E-08 8.49E-16 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 8.63E-10 4.04E-16 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 2.20E-06 NA mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 NA 2.91E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125391579 8.70E-06 3.52E-09 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251