\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125390548:

Variant ID: vg1125390548 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25390548
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, G: 0.07, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTTGTTTCTTGTTGATTGCAGGATCAAATCAACTGGCACGCTAGCATACCTGAAGGCGAGTTTTGGACCTGCACTAGAGTTAAGAAGATCTCCCAGGC[C/G]
TCGTGTTTTACATCAACACTTTGTGAGAAATCTTTTAAGCCTAATTGCTCCATGATTTGATAATATGGTGCTACAGTAAATATATACTAATGATAGATAA

Reverse complement sequence

TTATCTATCATTAGTATATATTTACTGTAGCACCATATTATCAAATCATGGAGCAATTAGGCTTAAAAGATTTCTCACAAAGTGTTGATGTAAAACACGA[G/C]
GCCTGGGAGATCTTCTTAACTCTAGTGCAGGTCCAAAACTCGCCTTCAGGTATGCTAGCGTGCCAGTTGATTTGATCCTGCAATCAACAAGAAACAAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.10% 18.70% 0.49% 0.76% NA
All Indica  2759 93.30% 4.90% 0.62% 1.23% NA
All Japonica  1512 61.60% 38.40% 0.07% 0.00% NA
Aus  269 59.10% 38.30% 1.86% 0.74% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 83.90% 9.70% 2.15% 4.30% NA
Indica III  913 96.60% 3.20% 0.11% 0.11% NA
Indica Intermediate  786 91.30% 6.20% 0.76% 1.65% NA
Temperate Japonica  767 66.60% 33.20% 0.13% 0.00% NA
Tropical Japonica  504 48.80% 51.20% 0.00% 0.00% NA
Japonica Intermediate  241 72.20% 27.80% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125390548 C -> DEL N N silent_mutation Average:36.287; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg1125390548 C -> G LOC_Os11g42160.1 upstream_gene_variant ; 3623.0bp to feature; MODIFIER silent_mutation Average:36.287; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg1125390548 C -> G LOC_Os11g42150-LOC_Os11g42160 intergenic_region ; MODIFIER silent_mutation Average:36.287; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125390548 1.75E-15 NA mr1238 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 9.50E-13 5.86E-13 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 8.00E-07 2.71E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 1.81E-09 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 4.05E-09 1.74E-09 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 1.14E-16 8.04E-23 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 2.23E-10 5.58E-10 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 2.29E-07 NA mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 8.92E-10 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 1.14E-07 1.34E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 1.28E-07 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 4.19E-07 1.04E-10 mr1945 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 4.91E-14 NA mr1238_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 2.89E-10 8.21E-11 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 8.82E-06 1.74E-06 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 1.05E-15 2.38E-26 mr1484_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 3.99E-10 6.59E-11 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 4.32E-07 4.32E-07 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 2.13E-14 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 2.75E-12 2.24E-12 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 7.13E-06 4.61E-06 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 5.54E-10 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 9.69E-07 2.69E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 NA 4.12E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 2.96E-10 2.39E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125390548 1.34E-07 1.34E-07 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251