\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125388576:

Variant ID: vg1125388576 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 25388576
Reference Allele: GTTAlternative Allele: ATT,G
Primary Allele: GTTSecondary Allele: ATT

Inferred Ancestral Allele : GTT (evidence from allele frequency in Oryza rufipogon: GTT: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CGACTGGGTACGGGGTACCAGATATAAATAGAATATCTTTAAGAGGACTCGGGTTAGGTTCTAAACTTGTATGTCAAGGAAATATCCGGGATCCTAGTCG[GTT/ATT,G]
ACGATTGTATTTTATCTGTAATCACATATTCCGTTAGGGATATGGACTGTATTTTGTAATACGGACCCCTTCCCCTATATAAGGAGGGGTCCGGGTCCCT

Reverse complement sequence

AGGGACCCGGACCCCTCCTTATATAGGGGAAGGGGTCCGTATTACAAAATACAGTCCATATCCCTAACGGAATATGTGATTACAGATAAAATACAATCGT[AAC/AAT,C]
CGACTAGGATCCCGGATATTTCCTTGACATACAAGTTTAGAACCTAACCCGAGTCCTCTTAAAGATATTCTATTTATATCTGGTACCCCGTACCCAGTCG

Allele Frequencies:

Populations Population SizeFrequency of GTT(primary allele) Frequency of ATT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 9.30% 0.04% 0.00% G: 5.33%
All Indica  2759 76.90% 15.20% 0.07% 0.00% G: 7.87%
All Japonica  1512 99.50% 0.40% 0.00% 0.00% G: 0.07%
Aus  269 87.70% 0.00% 0.00% 0.00% G: 12.27%
Indica I  595 54.30% 45.50% 0.17% 0.00% NA
Indica II  465 78.10% 20.00% 0.00% 0.00% G: 1.94%
Indica III  913 83.40% 0.00% 0.00% 0.00% G: 16.65%
Indica Intermediate  786 85.80% 7.00% 0.13% 0.00% G: 7.12%
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.00% G: 0.20%
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 0.00% 0.00% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125388576 GTT -> ATT LOC_Os11g42150.1 downstream_gene_variant ; 3392.0bp to feature; MODIFIER silent_mutation Average:40.921; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1125388576 GTT -> ATT LOC_Os11g42150-LOC_Os11g42160 intergenic_region ; MODIFIER silent_mutation Average:40.921; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1125388576 GTT -> G LOC_Os11g42150.1 downstream_gene_variant ; 3393.0bp to feature; MODIFIER silent_mutation Average:40.921; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1125388576 GTT -> G LOC_Os11g42150-LOC_Os11g42160 intergenic_region ; MODIFIER silent_mutation Average:40.921; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125388576 3.35E-11 1.96E-19 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 3.38E-11 3.59E-14 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 NA 4.72E-08 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 7.52E-07 2.72E-09 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 8.46E-14 1.85E-22 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 1.36E-12 1.42E-16 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 3.64E-10 1.00E-14 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 3.60E-10 2.95E-16 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 2.17E-06 1.71E-10 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 7.11E-14 7.59E-34 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 2.18E-13 9.82E-24 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 7.77E-08 2.87E-13 mr1530_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 2.13E-09 1.67E-17 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 7.91E-11 3.94E-19 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125388576 2.92E-06 5.50E-15 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251