Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125364222:

Variant ID: vg1125364222 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25364222
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

GCTGCAATCTCTGCATCAGCAAAGTGCTAAGCACATCGCTTCTTGGCTAATTCAGCTTGTTAACTTTTCCTGCCTTGATGGAAACGCCGGGCCGAAACCT[T/C]
CTCCGACCAGGATTAGGAGCTCGAGCTTGTTCATCGCCTGCTGTATCGGTTAACGCTTCTTCCTCCTCTCCTTGTGAATTATCTGCAGGAGACGATGTTT

Reverse complement sequence

AAACATCGTCTCCTGCAGATAATTCACAAGGAGAGGAGGAAGAAGCGTTAACCGATACAGCAGGCGATGAACAAGCTCGAGCTCCTAATCCTGGTCGGAG[A/G]
AGGTTTCGGCCCGGCGTTTCCATCAAGGCAGGAAAAGTTAACAAGCTGAATTAGCCAAGAAGCGATGTGCTTAGCACTTTGCTGATGCAGAGATTGCAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.70%	32.10%	0.25%	0.00%	NA
All Indica	2759	81.30%	18.40%	0.22%	0.00%	NA
All Japonica	1512	48.40%	51.30%	0.26%	0.00%	NA
Aus	269	44.20%	55.80%	0.00%	0.00%	NA
Indica I	595	87.10%	12.90%	0.00%	0.00%	NA
Indica II	465	60.90%	38.90%	0.22%	0.00%	NA
Indica III	913	88.90%	10.60%	0.44%	0.00%	NA
Indica Intermediate	786	80.30%	19.60%	0.13%	0.00%	NA
Temperate Japonica	767	19.20%	80.60%	0.26%	0.00%	NA
Tropical Japonica	504	87.70%	12.30%	0.00%	0.00%	NA
Japonica Intermediate	241	59.30%	39.80%	0.83%	0.00%	NA
VI/Aromatic	96	46.90%	53.10%	0.00%	0.00%	NA
Intermediate	90	64.40%	33.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125364222	T -> C	LOC_Os11g42100.1	downstream_gene_variant ; 4003.0bp to feature; MODIFIER	silent_mutation	Average:49.099; most accessible tissue: Callus, score: 98.005	N	N	N	N
vg1125364222	T -> C	LOC_Os11g42110.1	downstream_gene_variant ; 2310.0bp to feature; MODIFIER	silent_mutation	Average:49.099; most accessible tissue: Callus, score: 98.005	N	N	N	N
vg1125364222	T -> C	LOC_Os11g42120.1	downstream_gene_variant ; 4057.0bp to feature; MODIFIER	silent_mutation	Average:49.099; most accessible tissue: Callus, score: 98.005	N	N	N	N
vg1125364222	T -> C	LOC_Os11g42110-LOC_Os11g42120	intergenic_region ; MODIFIER	silent_mutation	Average:49.099; most accessible tissue: Callus, score: 98.005	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125364222	3.16E-09	2.83E-12	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125364222	4.22E-06	9.40E-08	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125364222	NA	2.38E-06	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125364222	NA	2.04E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125364222	NA	1.20E-12	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125364222	3.79E-10	4.14E-15	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125364222	NA	2.02E-08	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125364222	3.60E-06	NA	mr1648	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125364222	NA	1.70E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125364222	8.54E-06	3.61E-14	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125364222	NA	2.66E-08	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125364222	NA	6.37E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251