\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125360972:

Variant ID: vg1125360972 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25360972
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, T: 0.18, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAAATTACACTGAAATTATTCACAAAGGAAACATGCTCACTACAATTCTTCGTGCACGAAGAGTTACATTTCCTCAAGATGTTAGGGCCTGTTTGTTT[G/T]
AGTTGTAAAATTGATTGGGTCGAAGAAAATAGATGAATATTAATGCATGTTTATAGCCCATAGTACCACACCAACTGAGCCAAATAGCAATCGGGCTCTA

Reverse complement sequence

TAGAGCCCGATTGCTATTTGGCTCAGTTGGTGTGGTACTATGGGCTATAAACATGCATTAATATTCATCTATTTTCTTCGACCCAATCAATTTTACAACT[C/A]
AAACAAACAGGCCCTAACATCTTGAGGAAATGTAACTCTTCGTGCACGAAGAATTGTAGTGAGCATGTTTCCTTTGTGAATAATTTCAGTGTAATTTTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.50% 24.00% 0.57% 38.95% NA
All Indica  2759 24.40% 17.40% 0.83% 57.45% NA
All Japonica  1512 53.50% 33.60% 0.20% 12.70% NA
Aus  269 59.90% 26.00% 0.00% 14.13% NA
Indica I  595 14.30% 45.50% 0.67% 39.50% NA
Indica II  465 55.10% 21.50% 0.86% 22.58% NA
Indica III  913 12.00% 3.30% 0.88% 83.79% NA
Indica Intermediate  786 28.10% 9.90% 0.89% 61.07% NA
Temperate Japonica  767 81.10% 16.40% 0.13% 2.35% NA
Tropical Japonica  504 16.50% 54.80% 0.20% 28.57% NA
Japonica Intermediate  241 43.20% 44.00% 0.41% 12.45% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 35.60% 34.40% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125360972 G -> T LOC_Os11g42110.1 upstream_gene_variant ; 455.0bp to feature; MODIFIER silent_mutation Average:16.013; most accessible tissue: Callus, score: 82.835 N N N N
vg1125360972 G -> T LOC_Os11g42100.1 downstream_gene_variant ; 753.0bp to feature; MODIFIER silent_mutation Average:16.013; most accessible tissue: Callus, score: 82.835 N N N N
vg1125360972 G -> T LOC_Os11g42100-LOC_Os11g42110 intergenic_region ; MODIFIER silent_mutation Average:16.013; most accessible tissue: Callus, score: 82.835 N N N N
vg1125360972 G -> DEL N N silent_mutation Average:16.013; most accessible tissue: Callus, score: 82.835 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125360972 NA 9.84E-07 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972 1.60E-07 3.20E-12 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972 NA 5.02E-08 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972 NA 5.37E-08 mr1328 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972 NA 1.01E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972 8.94E-12 3.27E-19 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972 2.05E-07 3.74E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972 NA 3.34E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972 NA 4.53E-06 mr1826 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972 NA 3.39E-16 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972 NA 2.32E-11 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251