\
| Variant ID: vg1125360972 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25360972 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, T: 0.18, others allele: 0.00, population size: 104. )
CTAAAATTACACTGAAATTATTCACAAAGGAAACATGCTCACTACAATTCTTCGTGCACGAAGAGTTACATTTCCTCAAGATGTTAGGGCCTGTTTGTTT[G/T]
AGTTGTAAAATTGATTGGGTCGAAGAAAATAGATGAATATTAATGCATGTTTATAGCCCATAGTACCACACCAACTGAGCCAAATAGCAATCGGGCTCTA
TAGAGCCCGATTGCTATTTGGCTCAGTTGGTGTGGTACTATGGGCTATAAACATGCATTAATATTCATCTATTTTCTTCGACCCAATCAATTTTACAACT[C/A]
AAACAAACAGGCCCTAACATCTTGAGGAAATGTAACTCTTCGTGCACGAAGAATTGTAGTGAGCATGTTTCCTTTGTGAATAATTTCAGTGTAATTTTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.50% | 24.00% | 0.57% | 38.95% | NA |
| All Indica | 2759 | 24.40% | 17.40% | 0.83% | 57.45% | NA |
| All Japonica | 1512 | 53.50% | 33.60% | 0.20% | 12.70% | NA |
| Aus | 269 | 59.90% | 26.00% | 0.00% | 14.13% | NA |
| Indica I | 595 | 14.30% | 45.50% | 0.67% | 39.50% | NA |
| Indica II | 465 | 55.10% | 21.50% | 0.86% | 22.58% | NA |
| Indica III | 913 | 12.00% | 3.30% | 0.88% | 83.79% | NA |
| Indica Intermediate | 786 | 28.10% | 9.90% | 0.89% | 61.07% | NA |
| Temperate Japonica | 767 | 81.10% | 16.40% | 0.13% | 2.35% | NA |
| Tropical Japonica | 504 | 16.50% | 54.80% | 0.20% | 28.57% | NA |
| Japonica Intermediate | 241 | 43.20% | 44.00% | 0.41% | 12.45% | NA |
| VI/Aromatic | 96 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 34.40% | 1.11% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125360972 | G -> T | LOC_Os11g42110.1 | upstream_gene_variant ; 455.0bp to feature; MODIFIER | silent_mutation | Average:16.013; most accessible tissue: Callus, score: 82.835 | N | N | N | N |
| vg1125360972 | G -> T | LOC_Os11g42100.1 | downstream_gene_variant ; 753.0bp to feature; MODIFIER | silent_mutation | Average:16.013; most accessible tissue: Callus, score: 82.835 | N | N | N | N |
| vg1125360972 | G -> T | LOC_Os11g42100-LOC_Os11g42110 | intergenic_region ; MODIFIER | silent_mutation | Average:16.013; most accessible tissue: Callus, score: 82.835 | N | N | N | N |
| vg1125360972 | G -> DEL | N | N | silent_mutation | Average:16.013; most accessible tissue: Callus, score: 82.835 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125360972 | NA | 9.84E-07 | mr1157 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125360972 | 1.60E-07 | 3.20E-12 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125360972 | NA | 5.02E-08 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125360972 | NA | 5.37E-08 | mr1328 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125360972 | NA | 1.01E-06 | mr1446 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125360972 | 8.94E-12 | 3.27E-19 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125360972 | 2.05E-07 | 3.74E-12 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125360972 | NA | 3.34E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125360972 | NA | 4.53E-06 | mr1826 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125360972 | NA | 3.39E-16 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125360972 | NA | 2.32E-11 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |