Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125322548:

Variant ID: vg1125322548 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25322548
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTAAGGTACGGCAGATCCTCGAACATCCTGGAACGAAAGTGGTCGTAATTGTAGGAATGGCCGGGGCCGGGAAGACGAAGCTCACCAGGCATCTGCTG[T/A]
GCGAAATGTGTAGTGCTACTACGCATGGCTTCAACTACTCTCTTTGGGTTACAGTGTCCCAAGATTTCAATCCAGAATGGATTTATCGGCAGGTGATGTC

Reverse complement sequence

GACATCACCTGCCGATAAATCCATTCTGGATTGAAATCTTGGGACACTGTAACCCAAAGAGAGTAGTTGAAGCCATGCGTAGTAGCACTACACATTTCGC[A/T]
CAGCAGATGCCTGGTGAGCTTCGTCTTCCCGGCCCCGGCCATTCCTACAATTACGACCACTTTCGTTCCAGGATGTTCGAGGATCTGCCGTACCTTACAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.00%	22.30%	0.38%	35.34%	NA
All Indica	2759	61.10%	13.40%	0.14%	25.30%	NA
All Japonica	1512	14.40%	36.20%	0.46%	48.94%	NA
Aus	269	17.50%	22.30%	0.74%	59.48%	NA
Indica I	595	42.90%	6.20%	0.17%	50.76%	NA
Indica II	465	27.10%	38.90%	0.43%	33.55%	NA
Indica III	913	86.60%	4.10%	0.00%	9.31%	NA
Indica Intermediate	786	65.50%	14.60%	0.13%	19.72%	NA
Temperate Japonica	767	2.90%	55.40%	0.65%	41.07%	NA
Tropical Japonica	504	31.50%	10.70%	0.20%	57.54%	NA
Japonica Intermediate	241	14.90%	28.60%	0.41%	56.02%	NA
VI/Aromatic	96	2.10%	55.20%	3.12%	39.58%	NA
Intermediate	90	36.70%	23.30%	2.22%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125322548	T -> A	LOC_Os11g42070.1	missense_variant ; p.Cys236Ser; MODERATE	nonsynonymous_codon ; C236N	Average:76.63; most accessible tissue: Callus, score: 85.738	unknown	unknown	TOLERATED	0.44
vg1125322548	T -> A	LOC_Os11g42070.1	missense_variant ; p.Cys236Ser; MODERATE	nonsynonymous_codon ; C236S	Average:76.63; most accessible tissue: Callus, score: 85.738	unknown	unknown	TOLERATED	0.66
vg1125322548	T -> A	LOC_Os11g42070.2	missense_variant ; p.Cys236Ser; MODERATE	nonsynonymous_codon ; C236N	Average:76.63; most accessible tissue: Callus, score: 85.738	unknown	unknown	TOLERATED	0.44
vg1125322548	T -> A	LOC_Os11g42070.2	missense_variant ; p.Cys236Ser; MODERATE	nonsynonymous_codon ; C236S	Average:76.63; most accessible tissue: Callus, score: 85.738	unknown	unknown	TOLERATED	0.66
vg1125322548	T -> DEL	LOC_Os11g42070.1	N	frameshift_variant	Average:76.63; most accessible tissue: Callus, score: 85.738	N	N	N	N
vg1125322548	T -> DEL	LOC_Os11g42070.2	N	frameshift_variant	Average:76.63; most accessible tissue: Callus, score: 85.738	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125322548	NA	5.11E-12	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125322548	5.68E-07	3.66E-08	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125322548	7.32E-08	1.49E-09	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125322548	NA	5.07E-07	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125322548	NA	1.29E-14	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125322548	NA	3.21E-09	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125322548	4.44E-09	6.22E-09	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125322548	5.56E-11	3.76E-12	mr1662_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125322548	NA	6.22E-06	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251