\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125316910:

Variant ID: vg1125316910 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25316910
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTGGTGATCTCCTTTGCCAGCACCTGCAGATCGTGGCACGCCCTGAGATCCAACACGACCAGCTCGGCCAGTTCTCCAATGGCAGCCGGGATGGCCAT[A/G]
ATTCTCGATATGCCTCTCAAGCTGAGGTACCTCAGGTTCTTGCACGCCCCGATCCCCTTGAGGTGGTGGTCGTCGATCAGCTCGATGTGGCTCTTCCTTG

Reverse complement sequence

CAAGGAAGAGCCACATCGAGCTGATCGACGACCACCACCTCAAGGGGATCGGGGCGTGCAAGAACCTGAGGTACCTCAGCTTGAGAGGCATATCGAGAAT[T/C]
ATGGCCATCCCGGCTGCCATTGGAGAACTGGCCGAGCTGGTCGTGTTGGATCTCAGGGCGTGCCACGATCTGCAGGTGCTGGCAAAGGAGATCACCAAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 7.60% 1.95% 24.69% NA
All Indica  2759 75.50% 9.10% 0.87% 14.46% NA
All Japonica  1512 52.40% 3.00% 3.51% 41.14% NA
Aus  269 43.90% 21.20% 3.35% 31.60% NA
Indica I  595 51.90% 6.20% 2.52% 39.33% NA
Indica II  465 67.70% 14.00% 1.08% 17.20% NA
Indica III  913 90.70% 6.70% 0.00% 2.63% NA
Indica Intermediate  786 80.40% 11.30% 0.51% 7.76% NA
Temperate Japonica  767 61.50% 0.90% 3.13% 34.42% NA
Tropical Japonica  504 42.50% 4.60% 4.37% 48.61% NA
Japonica Intermediate  241 44.00% 6.20% 2.90% 46.89% NA
VI/Aromatic  96 60.40% 2.10% 4.17% 33.33% NA
Intermediate  90 63.30% 2.20% 2.22% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125316910 A -> DEL LOC_Os11g42060.1 N frameshift_variant Average:81.737; most accessible tissue: Zhenshan97 panicle, score: 94.195 N N N N
vg1125316910 A -> G LOC_Os11g42060.1 synonymous_variant ; p.Ile380Ile; LOW synonymous_codon Average:81.737; most accessible tissue: Zhenshan97 panicle, score: 94.195 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125316910 A G -0.01 -0.01 -0.01 -0.02 -0.02 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125316910 8.62E-13 2.24E-13 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125316910 1.82E-06 1.22E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125316910 6.00E-06 NA mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125316910 2.00E-07 1.49E-08 mr1841 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125316910 4.11E-09 1.31E-09 mr1238_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125316910 1.57E-09 7.58E-10 mr1484_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125316910 2.53E-09 1.79E-10 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251